B6;129S6-Pgr^{em1(icre/ERT2)Fjd}/J

Stock number: 040784
Product name: Pgr^iCreERT2
Research areas: Cell Biology Research, Developmental Biology Research, Endocrine Deficiency Research, Research Tools

Description

Pgr^iCreERT2 knock-in/knock-out mice have an icre/ERT2 sequence replacing exon 1 of the endogenous progesterone receptor gene. They are useful for applications requiring tamoxifen-induced deletion of floxed sequences in progesterone-responsive cells/tissues such as uterus, ovary, oviduct, pituitary gland, and mammary gland.

Detailed description

Pgr^iCreERT2 knock-in/knock-out mice have an icre/ERT2 sequence replacing exon 1 of the endogenous progesterone receptor (Pgr) gene, abolishing gene expression. These mice express icre/ERT2 in progesterone-responsive cells/tissues such as uterus, ovary, oviduct, pituitary gland, and mammary gland. Restricted to the cytoplasm, icre/ERT2 can only gain access to the nuclear compartment after exposure to tamoxifen. Homozygous males are viable and fertile while homozygous females are viable but completely infertile. When these mice are bred with mice containing loxP-flanked sequence, tamoxifen-inducible iCre-mediated recombination will result in deletion of the floxed sequences in progesterone-responsive cells/tissues of the offspring. The donating investigator reports minimal iCre activity is observed in the female reproductive tract without tamoxifen. Other tissues were not examined.

Development

A single guide (sgRNA) (GCTGTTGCTCCCTACCTCGGGG) was designed to replace exon 1 of the progesterone receptor (Pgr) with a codon-improved icre/ERT2 fusion gene (an icre recombinase fused to a human estrogen receptor ligand binding domain). sgRNA, the cas9 protein, and a donor plasmid were introduced into (129S6/SvEvTac x C57BL/6NCrl)F1-derived G4 embryonic stem (ES) cells. Correctly targeted ES cells were injected into recipient albino C57BL/6J blastocysts and Pgr^iCreERT2 offspring were identified by PCR and sequencing. Mice were backcrossed to C57BL/6J mice (Stock No. 000664) for at least 4 generations by the donating laboratory. Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Pgr^{em1(icre/ERT2)Fjd}
Name: endonuclease-mediated mutation 1, Franco J DeMayo
MGI accession ID: MGI:8216689
Generation method: Endonuclease-mediated
Attributes: Recombinase-expressing; Inducible; Null/Knockout
Synonyms: Pgr^iCreERT2
Marker symbol: Pgr
Marker name: progesterone receptor
Marker synonyms: 9930019P03Rik; ENSMUSG00000074510; NR3C3; PR; PR-A; PR-B
Chromosome: 9
Strain of origin: (129S6/SvEvTac x C57BL/6NCrl)F1
Molecular note: A single guide (sgRNA) (GCTGTTGCTCCCTACCTCGGGG) was designed to replace exon 1 of the progesterone receptor (Pgr) with a codon-improved icre/ERT2 fusion gene (an icre recombinase fused to a human estrogen receptor ligand binding domain).