STOCK Igs2^{em1(HNF4A-Gsta2,-H2B/EGFP)Amc}/J

Stock number: 040717
Product name: HNF4A-Gsta2-iresH2GFP
Research areas: Cardiovascular Research, Cell Biology Research, Developmental Biology Research, Endocrine Deficiency Research, Internal/Organ Research, Research Tools

Description

HNF4A-Gsta2-iresH2GFP mice carry an insertion of five human HNF4A enhancer regions, a minimal Shh promoter, the mouse Gsta2 gene, an IRES sequence, and an H2B-EGFP fusion protein all inserted into the safe harbor Igs2 locus. These mice are useful for expressing the mouse Gsta2 gene in proximal tubule cells and hepatocytes for studying sexually dimorphic resilience to ischemia-reperfusion injury. The H2BeGFP cassette enables the tagging and visualization of transgene expressing nuclei.

Detailed description

HNF4A-Gsta2-iresH2GFP mice carry an insertion of five human HNF4A enhancer regions, a minimal Shh promoter, the mouse Gsta2 gene, an IRES sequence, and an H2B-EGFP fusion protein all inserted into the safe harbor Igs2 locus. Genetic sex is an important determinant of renal injury and repair, with female kidneys typically exhibiting greater resilience to acute kidney injury (AKI). Among the sexually dimorphic genes in mouse proximal tubule cells (PTCs), Gsta2, an NRF2- regulated antioxidant enzyme, is strongly enriched in females.

In this mouse line, increased expression of the Gsta2 gene in proximal tubule cells and hepatocytes of males leads to enhanced resistance to ischemia-reperfusion injury (IRI). They display significantly higher glomerular filtration rates and attenuated fibrotic remodeling following IRI. Early-phase transcriptional analysis 4 hours post-injury show a reduced stress response, diminished DNA double-strand DNA breaks, and lower protein peroxidation. At later time points, fibrosis-associated transcripts (Acta2, Col1a1, and Col3a1) and markers of failed PTC repair (Havcr1, Vcam1, and Ccl2) were reduced in transgenic kidneys.



Homozygous mice are viable and fertile. The H2BeGFP cassette enables the tagging and visualization of transgene expressing nuclei by direct fluorescence and FACS analysis.

Development

Plasmids encoding a guide RNA (gRNA) (gctgatggaacaggtaacaa) were designed to target the safe harbor locus, intergenic site 2 (Igs2), for insertion of (from 5' to 3') five human hepatic nuclear factor 4, alpha (HNF4A) enhancer regions, a minimal sonic hedgehog (Shh) promoter, the mouse glutathione S-transferase, alpha 2 (Yc2) (Gsta2) gene, an internal ribosome entry site (IRES), and an H2B-EGFP fusion protein (coding sequence for the human HIST2B gene fused to an enhanced green fluorescent protein sequence). Cas9 protein, gRNA, and a donor vector were injected into fertilized C57BL/6J oocytes and embryos were transferred to pseudopregnant females. Correctly targeted HNF4A-Gsta2-iresH2GFP pups were identified by PCR and were further backcrossed to C57BL/6J inbred mice for at least 4 generations by the donating laboratory. This line was potentially bred to C57BL/6N mice during development (see SNP note below). Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).

In 2025, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the rederived living colony at The Jackson Laboratory Repository. Four of the 43 markers throughout the genome were segregating with an unknown source. Also, 3 of the 5 markers that determine C57BL/6J from C57BL/6N were found to be segregating. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed genetic background.

Allele

Symbol: Igs2^{em1(HNF4A-Gsta2,-H2B/EGFP)Amc}
Name: endonuclease-mediated mutation 1, Andrew P McMahon
MGI accession ID: MGI:8252963
Generation method: Endonuclease-mediated
Attributes: Reporter; Inserted expressed sequence
Marker symbol: Igs2
Marker name: intergenic site 2
Marker synonyms: H11; Hipp11; Iis2
Chromosome: 11
Strain of origin: C57BL/6J
Molecular note: Plasmids encoding a guide RNA (gRNA) (gctgatggaacaggtaacaa) were designed to target the safe harbor locus, intergenic site 2 (Igs2), for insertion of (from 5' to 3') five human hepatic nuclear factor 4, alpha (HNF4A) enhancer regions, a minimal sonic hedgehog (Shh) promoter, the mouse glutathione S-transferase, alpha 2 (Yc2) (Gsta2) gene, an internal ribosome entry site (IRES), and an H2B-EGFP fusion protein (coding sequence for the human HIST2B gene fused to an enhanced green fluorescent protein sequence).