C57BL/6NJ-Drd2^em2Knev/J

Stock number: 040690
Product name: Drd2^M6.36R
Research areas: Neurobiology Research

Description

Drd2^M6.36R knock-in mice have a point mutation resulting in an amino acid substitution (c.1121 T>G, p.Met374Arg) in the dopamine D2 receptor. These mice may be useful when studying pathogenesis of early-onset hyperkinetic movement disorders as well as relevant therapeutics.

Detailed description

Dopamine D2 receptors (coded by the Drd2 gene) are G protein-coupled receptors, located on dendrites and axon terminals of dopaminergic neurons and on postsynaptic neurons, that inhibit adenylyl cyclase activity. Dopamine (DA) stimulation of presynaptic D2 receptors (autoreceptors) induces a negative feedback regulation that reduces DA neuron firing, DA synthesis and DA release; whereas blockade of postsynaptic receptors may cause catalepsy. D2 receptors are targets for the treatment of a variety of neuropsychiatric disorders, including Parkinson's disease, myoclonus dystonia, schizophrenia, hyperactivity disorders, and compulsive drug abuse.

Drd^M6.36R knock-in (KI) mice carry a mutation that results in an amino acid substitution (M6.36R) in the dopamine D2 receptor, which causes an early-onset hyperkinetic movement disorder.

Heterozygous mice are viable and fertile; however, the viability and fertility of homozygous mice has not been evaluated to date. These heterozygous Drd^M6.36R mice demonstrate a more severe gait and locomotor phenotype compared to homozygous Drd2^I212F knock-in mice (Stock No. 039048), which also harbor a clinical mutation implicated in hyperkinetic movement disorders. This Drd^M6.36R KI strain may be useful for studying pathogenic Drd2 variants in early-onset hyperkinetic movement disorders.

Note that based on sequencing analysis performed by The Jackson Laboratory, utilizing the Ensembl transcript Drd2-201 (ENSMUST00000075764.8) as reference, the amino acid substitution location has been updated to M375R.

Development

The Drd2^M6.36R knock-in (KI) allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. Guide RNA [GAGCUUACUCACCAAGAACAA] was used to target exon 7 of the dopamine receptor D2 (Drd2) gene on chromosome 9. Drd2 transcript Drd2-201 (ENSMUST00000075764.8) was utilized as reference for the exon number and guide sequences. The guide RNA, donor sequence, with the mutant M374R mutation (c.1121 T>G, p.Met374Arg), and Cas9 nuclease were introduced into C57BL/6NJ zygotes and transferred to pseudopregnant females. Correctly targeted pups were identified by PCR and sequencing. The resulting heterozygous Drd2^M6.36R mice were bred to C57BL/6NJ mice for one generation by the donating laboratory. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6NJ oocytes (Stock No. 005304).

Note that based on sequencing analysis performed by The Jackson Laboratory, utilizing the Ensembl transcript Drd2-201 (ENSMUST00000075764.8) as reference, the amino acid substitution location has been updated to M375R.

Allele

Symbol: Drd2^em2Knev
Name: endonuclease-mediated mutation 2, Kim Neve
MGI accession ID: MGI:8209560
Generation method: Endonuclease-mediated
Attributes: Not Applicable
Synonyms: Drd2^M6.36R
Marker symbol: Drd2
Marker name: dopamine receptor D2
Marker synonyms: D2 receptor; D2DR; D2R; Drd-2
Chromosome: 9
Strain of origin: C57BL/6NJ
Molecular note: Using CRISPR/Cas9 endonuclease-mediated genome editing. Guide RNA [GAGCUUACUCACCAAGAACAA] was used to target exon 7 of the dopamine receptor D2 (Drd2) gene to introduce M375R mutation (c.1124 T>G, p.Met375Arg) using ENSMUST00000075764.8 Drd2-201 as reference.