C57BL/6N-Gt(ROSA)26Sor^{em2(CAG-Htr4*/GFP,-jRGECO1a)Yuli}/J

Stock number: 040686
Product name: gGRAB5-HT3.0-iP2A-jRGECO1a
Strain synonyms: LSL-g5-HT3.0-iP2A-jRGECO1a
Research areas: Neurobiology Research, Research Tools

Description

gGRAB_5-HT3.0-iP2A-jRGECO1a (also called LSL-g5-HT3.0-iP2A-jRGECO1a) reporter mice express a GPCR activation-based (GRAB) fluorescent sensor for serotonin (5-HT) and a fluorescent sensor for calcium. After removal of the loxP-flanked STOP cassette via Cre-mediated recombination, jRGECO1a and gGRAB_5-HT3.0 are independently expressed. The green fluorescent 5-HT sensor, gGRAB_5-HT3.0, and the red fluorescent calcium indicator, jRGECO1a, are used to simultaneously monitor cell-type-specific 5-HT release and calcium dynamics. This reporter strain is a valuable tool for monitoring the precise spatiotemporal release of serotonin in vivo and may provide new insights into the physiological and pathophysiological roles of 5-HT.

Detailed description

gGRAB_5-HT3.0-iP2A-jRGECO1a (also called LSL-g5-HT3.0-iP2A-jRGECO1a) reporter mice have a GPCR activation-based (GRAB) fluorescent sensor for serotonin (5-HT) and a fluorescent sensor for calcium introduced to the Gt(ROSA)26Sor locus. After removal of the loxP-flanked STOP cassette via Cre-mediated recombination, jRGECO1a and gGRAB_5-HT3.0 are independently expressed.

gGRAB_5-HT3.0 encodes a modified metabotropic 5-HT receptor fused to circularly permuted green fluorescent protein (cpEGFP). Upon serotonin binding, the receptor changes its conformation, leading to an increase in the fluorescent intensity of cpEGFP. This fluorescent sensor enables the monitoring of endogenous serotonin dynamics through changes in green fluorescence. The gGRAB_5-HT3.0 sensor and the red fluorescent calcium indicator, jRGECO1a, are used to simultaneously monitor cell-type-specific 5-HT release and calcium dynamics. This reporter strain is a valuable tool for monitoring the precise spatiotemporal release of serotonin in vivo and may provide new insights into the physiological and pathophysiological roles of 5-HT.

When bred to Vil-Cre mice (Stock No. 021504), Cre expression results in GRAB_NE2m and jRGECO1a expression in both serotonergic enterochromaffin (EC) cells and adjacent epithelial cells within crypts and villi.

In the presence of Cre, these mice express EGFP and RFP are detectable direct fluorescence and immunofluorescence.

Development

These gGRAB_5-HT3.0-iP2A-jRGECO1a mice have a GPCR activation-based serotonin (5-HT) sensor and a calcium sensor introduced to the Gt(ROSA)26Sor locus under control of the chicken beta-actin (CAG) promoter using CRISPR/cas9 methodologies (sgRNA: AAGGCCGCACCCTTCTCCGG AGG). The targeting construct was composed of (from 5' to 3') CAG-loxP-STOP-loxP-gGRAB_5-HT3.0-iP2A- jRGECO1a-WPRE-bGH pA. The STOP codon is composed of 5xSTOP sequences. jRGECO1a encodes a red fluorescent calcium sensor. gGRAB_5-HT3.0 encodes a modified metabotropic 5-HT receptor fused to circularly permuted green fluorescent protein (cpEGFP). The improved P2A (iP2A) ribosomal skip cleavage peptide sequence allows for independent expression of jRGECO1a and gGRAB_5-HT3.0 proteins.

Cas9 mRNA, sgRNA and the targeting vector were co-injected into the cytoplasm of one-cell stage fertilized C57BL/6NCrl eggs. The injected zygotes were transferred into oviducts of pseudo-pregnant females to generate F0 mice. F0 mice with expected genotype confirmed by PCR and sequencing were mated with C57BL/6NCrl mice to establish germline-transmission in F1 heterozygous mice. F1 heterozygous mice were genotyped by tail genomic PCR, DNA sequencing and Southern Blot. These mice were backcrossed to C57BL/6NCrl mice for at least 16 generations to remove off-target sites. Upon arrival, sperm was cryopreserved. To establish a live colony, an aliquot of frozen sperm was used to fertilize C57BL/6NJ oocytes (Stock No. 005304).

Allele

Symbol: Gt(ROSA)26Sor^{em2(CAG-Htr4*/GFP,-jRGECO1a)Yuli}
Name: endonuclease-mediated mutation 2, Yulong Li
MGI accession ID: MGI:8246660
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed); Reporter
Marker symbol: Gt(ROSA)26Sor
Marker name: gene trap ROSA 26, Philippe Soriano
Marker synonyms: beta geo; Gtrgeo26; Gtrosa26; R26; ROSA26; SETD5-AS1; Thumpd3as1
Chromosome: 6
Strain of origin: C57BL/6NCrl
Molecular note: Using CRISPR/Cas9 methodologies (sgRNA: AAGGCCGCACCCTTCTCCGG AGG), the targeting construct composed of (from 5' to 3') CAG-loxP-STOP-loxP-gGRAB)5-HT3.0(-iP2A- jRGECO1a-WPRE-bGH pA was inserted into Gt(ROSA)26Sor locus. The STOP codon is composed of 5xSTOP sequences. jRGECO1a encodes a red fluorescent calcium sensor. gGRAB)5-HT3.0( encodes a modified metabotropic 5-HT receptor fused to circularly permuted green fluorescent protein (cpEGFP).