C57BL/6N-Gt(ROSA)26Sor^{em1(CAG-jRGECO1a,-ADRA2A*/GFP)Yuli}/J

Stock number: 040685
Product name: LSL-dual-NECa
Strain synonyms: LSL-jRGECO1a-iP2A-NE2m
Research areas: Neurobiology Research, Research Tools

Description

LSL-dual-NECa (also called LSL-jRGECO1a-iP2A-NE2m) reporter mice express a GPCR activation-based (GRAB) fluorescent sensor for norepinephrine (NE) and a fluorescent sensor for calcium. After removal of the loxP-flanked STOP cassette via Cre-mediated recombination, jRGECO1a and GRAB_NE2m are independently expressed. The green fluorescent NE sensor, GRAB_NE2m, and the red fluorescent calcium indicator, jRGECO1a, are used to simultaneously monitor cell-type-specific NE release and calcium dynamics during the sleep-wake cycle, sensory processing, and locomotion. This reporter strain is a valuable tool for monitoring the precise spatiotemporal release of NE in vivo and may provide new insights into the physiological and pathophysiological roles of NE.

Detailed description

LSL-dual-NECa (also called LSL-jRGECO1a-iP2A-NE2m) reporter mice have a GPCR activation-based (GRAB) fluorescent sensor for norepinephrine (NE) and a fluorescent sensor for calcium introduced to the Gt(ROSA)26Sor locus. After removal of the loxP-flanked STOP cassette via Cre-mediated recombination, jRGECO1a and GRAB_NE2m are independently expressed. The green fluorescent NE sensor, GRAB_NE2m, and the red fluorescent calcium indicator, jRGECO1a, are used to simultaneously monitor cell-type-specific NE release and calcium dynamics during the sleep-wake cycle, sensory processing, and locomotion. This reporter strain is a valuable tool for monitoring the precise spatiotemporal release of NE in vivo and may provide new insights into the physiological and pathophysiological roles of NE.

When bred to CaMKIIα-Cre mice (Stock No. 005359), Cre expression results in GRAB_NE2m and jRGECO1a expression in excitatory neurons. Mice show a time-locked global increase in GRAB_NE2m fluorescence throughout the dorsal cortex after unilateral whisker stimulation, while the calcium signal increases only in the contralateral hemisphere, consistent with thalamocortical projections. Bilateral whisker stimulation induced a symmetrical concurrent increase in both NE and calcium.

When bred to GFAP-Cre mice (Stock No. 024098), Cre expression results in GRAB_NE2m and jRGECO1a expression in astrocytes. Mice show a time-locked global increase in GRAB_NE2m fluorescence throughout the dorsal cortex after unilateral whisker stimulation, but have a relatively small and delayed calcium signal increase during both unilateral and bilateral whisker stimulation.

In the presence of Cre, these mice express EGFP and RFP are detectable direct fluorescence and immunofluorescence.

Development

These LSL-dual-NECa mice have a GPCR activation-based norepinephrine sensor and a calcium sensor introduced to the Gt(ROSA)26Sor locus under control of the chicken beta-actin (CAG) promoter using CRISPR/cas9 methodologies (sgRNA: AAGGCCGCACCCTTCTCCGGAGG). The targeting construct was composed of (from 5' to 3') CAG-loxP-STOP-loxP-jRGECO1a-iP2A-GRAB_NE2m-WPRE-bGH pA. The STOP codon is composed of a pBS302 STOP cassette. jRGECO1a encodes a red fluorescent calcium sensor. GRAB_NE2m encodes a second-generation GPCR-activation-based green fluorescent norepinephrine sensor (variant of Adra2a) designed to have superior response, and high sensitivity and selectivity to norepinephrine both in vitro and in vivo. The improved P2A (iP2A) ribosomal skip cleavage peptide sequence allows for independent expression of jRGECO1a and GRAB_NE2m proteins.

Cas9 mRNA, sgRNA and the targeting vector were co-injected into the cytoplasm of one-cell stage fertilized C57BL/6NCrl eggs. The injected zygotes were transferred into oviducts of pseudo-pregnant females to generate F0 mice. F0 mice with expected genotype confirmed by PCR and sequencing were mated with C57BL/6NCrl mice to establish germline-transmission in F1 heterozygous mice. F1 heterozygous mice were genotyped by tail genomic PCR, DNA sequencing and Southern Blot. These mice were backcrossed to C57BL/6NCrl mice for at least 16 generations to remove off-target sites. Upon arrival, sperm was cryopreserved. To establish a live colony, an aliquot of frozen sperm was used to fertilize C57BL/6NJ oocytes (Stock No. 005304).

Allele

Symbol: Gt(ROSA)26Sor^{em1(CAG-jRGECO1a,-ADRA2A*/GFP)Yuli}
Name: endonuclease-mediated mutation 1, Yulong Li
MGI accession ID: MGI:8246652
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed); Reporter
Synonyms: dual-NECa
Marker symbol: Gt(ROSA)26Sor
Marker name: gene trap ROSA 26, Philippe Soriano
Marker synonyms: beta geo; Gtrgeo26; Gtrosa26; R26; ROSA26; SETD5-AS1; Thumpd3as1
Chromosome: 6
Strain of origin: C57BL/6NCrl
Molecular note: Using CRISPR/cas9 methodologies (sgRNA: AAGGCCGCACCCTTCTCCGGAGG), the targeting construct composed of (from 5' to 3') CAG-loxP-STOP-loxP-jRGECO1a-iP2A-GRAB)NE2m(-WPRE-bGH pA was inserted into Gt(ROSA)26Sor locus. The STOP codon is composed of a pBS302 STOP cassette. jRGECO1a encodes a red fluorescent calcium sensor. GRAB)NE2m (encodes a second-generation GPCR-activation-based green fluorescent norepinephrine sensor (variant of Adra2a).