C57BL/6J-Ptpn14^em1Att/J

Stock number: 040676
Product name: Ptpn14^fl
Research areas: Cancer Research, Cell Biology Research, Internal/Organ Research, Research Tools

Description

Ptpn14^fl/fl mice have loxP sites flanking exon 3 of the Ptpn14 gene. PTPN14 is a component of the Hippo pathway and a mediator of tumor suppression by the p53 tumor suppressor protein. These mice may be useful when studying p53-mediated tumor suppression, development, injury responses, and normal tissue function.

Detailed description

Ptpn14^fl/fl mice have loxP sites flanking exon 3 of the protein tyrosine phosphatase, non-receptor type 14 (Ptpn14) gene. Ptpn14 encodes a component of the Hippo pathway, which is a highly conserved signaling pathway that regulates cellular proliferation, survival, polarity, cell fate, and, at the macroscopic level, organ size. The Hippo pathway is involved in the regulation of many physiological processes, including development, tumor suppression, and wound healing.

Mice that are homozygous for the floxed allele are viable and fertile. When bred to mice that express tissue-specific Cre recombinase, resulting offspring will have exon 3 deleted in the cre-expressing tissues.

When bred to mice with widespread expression of Cre recombinase, resulting Ptpn14^-/- mice were born at lower than Mendelian ratios and display reduced survival compared to wildtype mice. They develop corneal lesions, hydrometra, as well as heart and kidney abnormalities. The knock-out mice also display a lower body weight at weaning, and they have larger hearts than wildtype mice. Female Ptpn14^-/- mice also develop dystocia and other birthing issues at a higher rate than wildtype mice and many female breeders appear infertile. These mice may be useful when studying p53-mediated tumor suppression, development, injury responses, and normal tissue function.

Development

Single strand guide RNAs (sgRNAs) (GGCCTACGATCTC and CCAGGAGGCTTCCGGCGAAG) were designed to target introns 2 and 3 of the protein tyrosine phosphatase, non-receptor type 14 (Ptpn14) gene for insertion of loxP sites. A mixture of sgRNA, Cas9 protein, and single stranded donor DNA were injected into pronuclei of zygotes derived from C57BL/6J mice. Correctly targeted embryos were transferred to pseudopregnant females. Ptpn14^fl pups were identified by PCR and DNA sequencing and founder mice were further bred to C57BL/6J mice for at least 8 generations to develop the colony. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).

Allele

Symbol: Ptpn14^em1Att
Name: endonuclease-mediated mutation 1, Laura D Attardi
MGI accession ID: MGI:8205029
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed)
Marker symbol: Ptpn14
Marker name: protein tyrosine phosphatase, non-receptor type 14
Marker synonyms: C130080N23Rik; CATLPH; OTTMUSG00000022087; PEZ; PTP36; PTPD2
Chromosome: 1
Strain of origin: C57BL/6J
Molecular note: Using CRISPR technology, single strand guide RNAs (sgRNAs) (GGCCTACGATCTC and CCAGGAGGCTTCCGGCGAAG) were designed to target introns 2 and 3 of the protein tyrosine phosphatase, non-receptor type 14 (Ptpn14) gene for insertion of loxP sites.