B6(Cg)-Ctsd^{em1(tetO)Aduci} Igs2^{em1(Camk2a-rtTR/KRAB,-mCherry)Aduci} App^tm1.1Aduci/LsrngJ

Stock number: 040641
Product name: Ctsd-TRE-Dox hAβwt
Research areas: Mouse/Human Gene Homologs, Neurobiology Research, Research Tools

Description

Ctsd-TRE-Dox is a triple mutant line generated by crossing Ctsd-TRE-Lox mice, CaMKIIα-rtTRKRAB mice, and hAΒwt-loxP-KI mice (Stock No. 031050). This is a novel mouse line developed to enable neuron-specific downregulation of CatD via administration of doxycycline (Dox) to facilitate the investigation of its role in the pathogenesis of Alzheimer's disease and related disorders.

Detailed description

Ctsd-TRE-Dox is a novel triple mutant line generated by crossing Ctsd-TRE-Lox mice, CaMKIIα-rtTRKRAB mice, and hAbeta-loxP-KI mice (Stock No. 031050). It was developed to enable neuron-specific downregulation of CatD via administration of doxycycline (Dox) to facilitate the investigation of its role in the pathogenesis of Alzheimer's disease and related disorders.

The hAbeta-loxP-KI allele carries a floxed humanized Abeta1-42 region of amyloid beta precursor protein (G601R, F606Y, R609H in the mouse App gene, corresponding to amino acid positions 676, 681, 684 in human APP). The Ctsd-TRE-Lox allele carries a doxycycline-inducible TRE-Lox cassette inserted into the cathepsin D (Ctsd) gene. The initiation codon in exon 1 of the Ctsd gene is also flanked by loxP sites, permitting irreversible genetic deletion of Ctsd. The CaMKIIα-rtTRKRAB transgene enables neuron-specific expression of a rtTR/KRAB fusion protein. The CaMKIIα-rtTRKRAB transgene also contains an IRES-mCherry fusion protein downsteam of the KRAB sequence. the donating investigator reports low mCherry expression that may require the use of immunfluorescence for detection.

Ctsd encodes an aspartyl protease, CatD, that degrades both the amyloid β-protein (Aβ) and the microtubule-associated protein, tau, two proteins that accumulate abnormally in Alzheimer's disease (AD). The TRE permits Dox-inducible downregulation of CatD expression in the presence of the rtTR. In the presence of Dox, the rtTRKRAB fusion protein binds to tetO sequences, and the KRAB domain recruits machinery that triggers localized histone methylation and consequent chromatin remodeling in a region 2-3 kb surrounding the TRE, which silences gene expression in a fully reversible manner.

Important note about App isoforms and exon numbering: The App-201 isoform (695 aa protein) is encoded by 16 exons, of which the Abeta sequence is encoded by exon 14. The App-206 isoform (770 aa protein) is encoded by 18 exons, of which the Abeta sequence is encoded by exon 16.

Development

Two sgRNAs (GGGAGTCTTCATGGTCGCGG and ACCTGGAGTGCCGCGTGCTC) were designed to target the cathepsin D (Ctsd) gene for insertion of a TRE-Lox sequence. Specifically, the TRE-Dox cassette includes a tetracycline response element (TRE) sequence, comprising seven repeats of the tetracycline operon (tetO) within the first intron plus two tetO repeats in the 5' untranslated region (UTR) in exon 1 of the Ctsd gene (based on Ctsd ENSMUST00000151120.9). In addition, two loxP sites were inserted into the Ctsd gene, one in the 5' UTR and the other in the first intron, such that they flank the initiation codon within exon 1. sgRNA, the cas9 protein, and a de novo synthesized single-stranded TRE-Lox sequence were introduced into C57BL/6J-derived embryos with well-recognized pronuclei. Injected embryos were transferred to pseudopregnant females. Resulting Ctsd-TRE-Lox mice were identified by PCR and sequencing, and correctly targeted offspring were further bred to hAbeta-loxP-KI (hAΒwt) mice (Stock No. 031050) mice for at least 6 generations by the donating laboratory to remove any off-target CRISPR sites.

A second modification used a sgRNA (GAACACTAGTGCACTTATCC) to introduce a rtTR/KRAB fusion protein sequence and mCherry fluorescent protein sequence under control of the calcium/calmodulin-dependent protein kinase II alpha (Camk2a) promoter into the safe harbor intergenic site 2 (Igs2 or Hipp11) locus. Specifically, rtTR/KRAB contains a 3rd generation reverse tetracycline repressor (rtTR) cloned from rtTA lacking the VP16 domain and also carrying a V9I mutation for increased sensitivity and an SV40 NLS. The rtTR sequence was fused to the transcriptional-repressing KRAB domain from the human zinc finger protein 10 (ZNF10) gene. An internal ribosome entry site (IRES) fused to an mCherry sequence was inserted downstream of the rtTR/KRAB fusion protein. This CaMKIIα-rtTRKRAB targeting vector was electroporated into embryos derived from homozygous hAbeta-loxP-KI mice. The resulting mice were bred to hAbeta-loxP-KI mice, both with and without the Ctsd-TRE-Lox insert for for at least 10 generations by the donating laboratory.

Homozygous Ctsd-TRE-Lox mice and CaMKIIα-rtTRKRAB mice were bred together and double homozygous mice were further bred to homozygous hAbeta-loxP-KI mice to generate this triple mutant Ctsd-TRE-Dox mouse line. Upon arrival at The Jackson Laboratory, embryos were cryopreserved. To establish our live colony, an aliquot of frozen embryos was recovered.

Allele

Symbol: App^tm1.1Aduci
Name: targeted mutation 1.1, Frank LaFerla
MGI accession ID: MGI:6120494
Generation method: Targeted
Attributes: Conditional ready (e.g. floxed); Humanized sequence
Synonyms: hABeta-KI
Marker symbol: App
Marker name: amyloid beta (A4) precursor protein
Marker synonyms: AAA; Abeta; ABPP; AD1; Adap; alpha-sAPP; APPI; appican; betaAPP; CTFgamma; Cvap; E030013M08Rik; PN2; PN-II; preA4; protease nexin II
Chromosome: 16
Strain of origin: C57BL/6N
Molecular note: The targeting construct includes a loxP site upstream of exon 16 of App-206 isoform, 3 point mutations inserted into exon 14 to create amino acid substitutions (amino acids 5 (G->R), 10 (F->Y) and 13 (R->H)) (ENSMUSE00000131684), a loxP site downstream of exon 16 and a FRT-flanked neo selection cassette, which is removed by FLP-mediated recombination.

Allele

Symbol: Ctsd^{em1(tetO)Aduci}
Name: endonuclease-mediated mutation 1, Frank LaFerla
MGI accession ID: MGI:8245110
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed); Inducible
Marker symbol: Ctsd
Marker name: cathepsin D
Marker synonyms: CatD; CD; CLN10; CPSD; HEL-S-130P
Chromosome: 7
Strain of origin: C57BL/6J
Molecular note: Two sgRNAs (GGGAGTCTTCATGGTCGCGG and ACCTGGAGTGCCGCGTGCTC) waere designed to target the cathepsin D (Ctsd) gene for insertion of a TRE-Lox sequence. Specifically, the TRE-Dox cassette includes a tetracycline response element (TRE) sequence, comprising seven repeats of the tetracycline operon (tetO) within the first intron plus two tetO repeats in the 5' untranslated region (UTR) in exon 1 of the Ctsd gene. In addition, two loxP sites were inserted into the Ctsd gene, one in the 5' UTR and the other in the first intron, such that they flank the initiation codon within exon 1.

Allele

Symbol: Igs2^{em1(Camk2a-rtTR/KRAB,-mCherry)Aduci}
Name: endonuclease-mediated mutation 1, Frank LaFerla
MGI accession ID: MGI:8245140
Generation method: Endonuclease-mediated
Attributes: Reporter; Transactivator
Marker symbol: Igs2
Marker name: intergenic site 2
Marker synonyms: H11; Hipp11; Iis2
Chromosome: 11
Strain of origin: B6(Cg)-App^tm1.1Aduci/J
Molecular note: AsgRNA (GAACACTAGTGCACTTATCC) to introduce a rtTR/KRAB fusion protein sequence followed by an IRES-mCherry under control of the calcium/calmodulin-dependent protein kinase II alpha (Camk2a) promoter into the safe harbor intergenic site 2 (Igs2 or Hipp11) locus. Specifically, rtTR/KRAB contains a 3rd generation reverse tetracycline repressor (rtTR) cloned from rtTA lacking the VP16 domain and also carrying a V9I mutation for increased sensitivity and an SV40 NLS. The rtTR sequence was fused to the transcriptional-repressing KRAB domain from the human zinc finger protein 10 (ZNF10) gene, and an IRES-mCherry was inserted. This Camk2a-rtTR/KRAB,-mCherry targeting vector was electroporated into embryos derived from homozygous App^tm1.1Aduci hAbeta-loxP-KI mice.