C57BL/6J-Igha^em2Aben/J

Stock number: 040630
Product name: Ighasec^-
Strain synonyms: Secretory IgA deficient 
Research areas: Cancer Research, Immunology, Inflammation and Autoimmunity Research, Virology Research

Description

Secretory Igha deficient (Ighasec^-) mice lack the secretory tailpiece and downstream secretory polyadenylation signal (CSα + polyA) sequence of the Igha gene. This mutation allows for B cells to express IgA on the cell surface, but these IgA-switched cells are not able to be secreted into the circulatory system. These mice may be useful when studying immune and inflammatory response pathways.

Of note, the donating laboratory has also made a Classical Igha knock-out (KO) strain available as Stock No. 040629.

Detailed description

Immunoglobin A is the primary immunoglobulin isotype induced at the mucosal surface and plays a vital role in maintaining immune homeostasis. These secretory Igha deficient (Ighasec^-) mice lack the secretory tailpiece and downstream secretory polyadenylation signal (CSα + polyA) sequence of the immunoglobulin heavy constant alpha (Igha) gene. This mutation results allows for the secretory IgA deficient B cells to retain the ability to class switch and express IgA on the cell surface, but the IgA-switched B cells are incapable of maturing into IgA plasma cells resulting in an inability to secrete IgA. Homozygous mice are viable and fertile. Ighasec^- mice demonstrate circulating IgM levels similar to wildtype controls.

It is recommended that these mice are maintained in a specific pathogen-free environment (SPF).

Of note, the donating laboratory has also made a Classical Igha knock-out (KO) strain available as Stock No. 040629.

Development

The Secretory IgA deficient (Ighasec^-) allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. Guide RNAs (TGTCTGTGATCATGTCAGA and GGGGCCATCTCAAGAACTGC) were used to delete the secretory tailpiece and downstream secretory polyadenylation signal (CSα + polyA) sequence of the immunoglobulin heavy constant alpha (Igha) gene, on chromosome 12. Igha transcript Igha-201 (ENSMUST00000178282.3) was used as reference for the exon number and the guide sequences. The sgRNA, donor DNA, and Cas9 nuclease were introduced into the cytoplasm of zygotes derived from C57BL/6J mice with well recognized pronuclei. Correctly targeted pups were identified by PCR and sequencing. The resulting Ighasec^- mice were crossed to C57BL/6J mice for 4 generations by the donating laboratory to reduce off-target events. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J (Stock No. 000664) oocytes.

Allele

Symbol: Igha^em2Aben
Name: endonuclease-mediated mutation 2, Albert Bendelac
MGI accession ID: MGI:8221767
Generation method: Endonuclease-mediated
Attributes: Modified regulatory region
Synonyms: Ighasec-
Marker symbol: Igha
Marker name: immunoglobulin heavy constant alpha
Marker synonyms: IgA; IgA1; Igh-2
Chromosome: 12
Strain of origin: C57BL/6J
Molecular note: Using CRISPR/Cas9 endonuclease-mediated genome editing, guide RNAs (TGTCTGTGATCATGTCAGA and GGGGCCATCTCAAGAACTGC) were used to delete the secretory tailpiece and downstream secretory polyadenylation signal (CS alpha + polyA) sequence of the immunoglobulin heavy constant alpha (Igha) gene.