B6;SJL-Nectin3^em1Xwlu/J

Stock number: 040611
Product name: Nectin3 KO , Nectin3^del10
Research areas: Cancer Research, Cell Biology Research, Developmental Biology Research, Neurobiology Research, Reproductive Biology Research, Sensorineural Research

Description

Nectin3^del10 mice have a 10bp deletion in exon 2 of the Nectin3 gene resulting incomplete loss of NECTIN3 protein. These mice may be useful for studying the role of Nectin3 in ciliary body formation as well as ocular and auditory development.

Detailed description

The nectin cell adhesion molecule 3 (Nectin3) gene codes for a protein involved in forming and maintaining cell junctions, particularly in the nervous system and epithelia. NECTIN3 protein plays a role in ciliary body development and function. Mutations in this gene have been associated with congenital ocular defects and male infertility. These Nectin3^del10 mice have a 10bp deletion in the beginning of exon 2 of the Nectin3 gene, resulting in a frameshift and early STOP codon leading to complete loss of all NECTIN3 protein.

Heterozygous mice are viable and fertile with no overt phenotype. Homozygous females and males are viable; however homozygous males are sterile. Both homozygous females and males demonstrate microphthalmia and inner ear defects. These mice may be useful when studying epithelial morphogenesis and ciliary body formation, as well as ocular and inner ear development.

Development

The Nectin3^del10 allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. A single guide RNA (CTTAGCTGGATCAATTATTG) was used to generate a 10bp deletion (sequences deleted: GAGCCACATG) in coding exon 2 of the nectin cell adhesion molecule 3 (Nectin3) gene on chromosome 16. Nectin3 transcript Nectin3-201 (ENSMUSP00000023334.9) was used as reference for the coding exon number and the guide sequences. The sgRNAs, ssDNA, and Cas9 nuclease were introduced into the cytoplasm of zygotes derived from B6SJLF1 mice with well recognized pronuclei. Correctly targeted pups were identified by PCR and sequencing. The resulting Nectin3^del10 mice were crossed to B6SJL mice for three generations by the donating laboratory. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize B6SJLF1/J oocytes (Stock No. 100012).

In 2026, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the males sent to The Jackson Laboratory Repository. All 5 markers that determine C57BL/6J from C57BL/6N were found to be segregating, including the rd8 recessive mutation associated with retinal degeneration on Chromosome 1 within the Crb1 locus.

Allele

Symbol: Nectin3^em1Xwlu
Name: endonuclease-mediated mutation 1, Xiaowei Lu
MGI accession ID: MGI:8215608
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Synonyms: Nectin3^del10
Marker symbol: Nectin3
Marker name: nectin cell adhesion molecule 3
Marker synonyms: 2610301B19Rik; 3000002N23Rik; 4921513D19Rik; CD113; CDW113; NECTIN-3; PPR3; PRR3; Pvrl3; PVRR3
Chromosome: 16
Strain of origin: (C57BL/6J x SJL)F1
Molecular note: Using CRISPR/Cas9 endonuclease-mediated genome editing, a single guide RNA (CTTAGCTGGATCAATTATTG) was used to generate a 10bp deletion (sequences deleted: GAGCCACATG) in coding exon 2 of the nectin cell adhesion molecule 3 (Nectin3) gene.