B6.129-Slc39a14^em1Crj/J

Stock number: 040519
Product name: Zip14^F
Strain synonyms: B6NHsd.129-Slc39a14^em1Crj/J
Research areas: Internal/Organ Research, Metabolism Research, Research Tools

Description

Zip14^F/F mice have loxP sites flanking exons 5-8 of the Slc39a14 gene. These mice may be useful when studying the role of Zip14-mediated metal transport in manganese and zinc homeostasis.

Detailed description

Zip14^F/F mice have loxP sites flanking exons 5-8 of the solute carrier family 39 (zinc transporter), member 14 (Slc39a14) gene. Slc39a14 encodes a zinc transporter that mediates the cellular uptake of manganese, zinc, iron, and cadmium that are important for tissue homeostasis, metabolism, development and immunity. Increased expression is induced by proinflammatory stimuli in liver, white adipose tissue, and skeletal muscle. At steady state, Zip14 is located at the basolateral membrane of intestinal epithelial cells (IECs) where it is required to maintain tight junctions and the intestinal permeability.

Mice that are homozygous for this allele are viable and fertile. When bred to mice that express tissue-specific Cre recombinase, resulting offspring will have exons 5-8 deleted in the cre-expressing tissues.

When bred to Villin-Cre mice (Stock No. 004586), resulting enterocyte-specific Zip14^ΔIEC mice exhibit selective dysbiosis and differential expression of tight junction proteins, claudin 1 and 2, and specific cytokines associated with intestinal inflammation. HDAC activity and zinc uptake are also reduced.

Development

Guide RNAs (GGGTGGGTGCCTACAGCTTCC, GGTGAACTGGCACCCTCCTC, and GGGAAACAACTTGTGGGACT) were designed to target introns 4 and 8 of the solute carrier family 39 (zinc transporter), member 14 (Slc39a14) gene for insertion of loxP sites. Guide RNAs, Cas9 protein, and donor DNA were introduced into the cytoplasm of zygotes derived from 129 mice. Correctly targeted embryos were transferred to pseudopregnant females. Zip14^F pups were identified and founder mice were further bred to C57BL/6NHsd mice for at least 20 generations by the donating laboratory (see SNP note below) to develop the colony and to remove any off-target CRISPR changes. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6NJ oocytes (Stock No. 005304).

In 2025, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the males sent to The Jackson Laboratory Repository. Three of the 5 markers that determine C57BL/6J from C57BL/6N were found to be segregating. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed C57BL/6N;C57BL/6J genetic background.

Allele

Symbol: Slc39a14^em1Crj
Name: endonuclease-mediated mutation 1, Robert J Cousins
MGI accession ID: MGI:7562111
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed); No functional change
Synonyms: Zip14^fl; Zip14^flox
Marker symbol: Slc39a14
Marker name: solute carrier family 39 (zinc transporter), member 14
Marker synonyms: cig19; G630015O18Rik; HCIN; HMNDYT2; LZT-Hs4; MGC:38539; NET34; Zip14
Chromosome: 14
Strain of origin: 129
Molecular note: LoxP sites were inserted in introns 4 and 8 via CRISPR/Cas9 technology.