C57BL/6N-Fzd1^em1Lsg/Mmjax

Stock number: 040458
Product name: Fzd1 knock-out
Research areas: Cancer Research, Developmental Biology Research, Neurobiology Research

Description

Fzd1 knock-out (KO) mice have a 1891-bp deletion in the coding region of the Fzd1 gene. These KO mice may be useful when studying the role of FZD1 in embryonic development, neurogenesis and tumorigenesis.

Detailed description

Fzd1 (frizzled class receptor 1) codes for one of the frizzled receptors (FZDs), which are 7-pass transmembrane proteins that primarily act as WNT receptors and play an important role in embryonic development, neurogenesis, and tumorigenesis. These Fzd1 knock-out (KO) mice have a 1891-bp deletion, resulting in removal of 614 of the 643 amino acids in the Fzd1 coding region.

Both heterozygous and homozygous mice are viable and fertile. The donating laboratory notes that homozygous KO mice demonstrated altered sleep patterns, including increases in the frequency and length of daytime sleeping and decreases in night sleep. Homozygous Fzd1 KO mice also showed an increase in anxiety-like behavior as measured by increased edge time and immobility in open-field conditions.

Development

The Fzd1 knock-out (KO) allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. Guide RNAs (ACTTTGTGCCGAAGCACTCC and CCTGGAGGAAGTTCTACACG) were used to target the frizzled class receptor 1 (Fzd1) gene on chromosome 5. This KO allele was designed to delete a 1891-bp region of the Fzd1 gene. Guide RNAs, cas9 mRNA, and donor template were introduced to single cell C57BL/6NCrl zygotes and transferred to pseudo pregnant females. Progeny were screened by DNA sequencing to identify correctly targeted pups, which were then bred to C57BL/6N mice for germline transmission. The colony was backcrossed to C57BL/6N for at least five generations by the donating laboratory. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish a live colony, an aliquot of frozen sperm was used to fertilize C57BL/6NJ (JAX Stock No. 005304) oocytes.

Allele

Symbol: Fzd1^em1Lsg
Name: endonuclease-mediated mutation 1, Susan T Harbison
MGI accession ID: MGI:7867570
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Synonyms: Fzd1^-
Marker symbol: Fzd1
Marker name: frizzled class receptor 1
Marker synonyms: Fz1; FZ-1
Chromosome: 5
Strain of origin: C57BL/6NCrl
Molecular note: Using CRISPR/Cas9 endonuclease-mediated genome editing, guide RNAs (ACTTTGTGCCGAAGCACTCC and CCTGGAGGAAGTTCTACACG) were used to target the frizzled class receptor 1 (Fzd1) gene on chromosome 5. This KO allele was designed to delete a 1891-bp region of the Fzd1 gene, eliminating most of the 1929-nt Fzd1 coding region.