C57BL/6J-Trem2^{em6(TREM2*T96K)Aduci}/J

Stock number: 040408
Product name: hTREM2^T96K
Research areas: Mouse/Human Gene Homologs, Neurobiology Research

Description

hTREM2^T96K mice contain human TREM2 sequence with a T96K mutation, replacing the corresponding mouse sequence. These mice may be useful in pre-clinical studies of neurodegenerative disease, including Alzheimer's disease (AD) as well as in studies of TREM2 function in non-CNS myeloid lineages.

Detailed description

Triggering receptor expressed on myeloid cells 2 (Trem2), encodes a cell surface receptor that binds polyanionic ligands including phospholipids and bacterial lipopolysaccharide. Intracellularly, TREM2 conveys signals via DAP12 (aka TYROBP) to activate myeloid lineage cells during immune responses. In this humanized TREM2 knock-in strain (hTREM2^T96K), mouse genomic DNA between the initiator translation codon in exon 1 and the translation termination codon in exon 5 was replaced by the corresponding human genomic DNA sequence. The human TREM2 sequence contained an ACG to AAG missense mutation at amino acid position 96, resulting in a threonine to lysine mutation (T96K) orthologous to the location of human SNP rs2234253. Human SNP rs2234253 has been associated with an increased risk of Alzheimer's disease (AD), including in Tunisian and African American populations. The T96K variant has been shown to reduce affinity for C1q in a biochemical study. If additional characterization of these mice is performed, we may modify the strain description accordingly.

Both heterozygous and homozygous mice are viable and fertile.

Of note, hTREM2 _KI mice, carrying the wildtype human TREM2, serve as a control for this hTREM2^T96K mouse line and are available as Stock No. 038103.

The UCI MODEL-AD Center has made other Alzheimer's disease models with mutant human TREM2 expression available:
hTREM2*R47H_KI mice, carrying the human TREM2 with a R47H amino acid substitution, are available as Stock No. 037497
hTREM2^L211P mice, carrying the human TREM2 with a L211P amino acid substitution, are available as Stock No. 40409

Development

A guide RNA (GCACTCTCACCATTACGCTG) was designed to introduce an ACG to AAG missense mutation at amino acid position 96 of the human triggering receptor expressed on myeloid cells 2 (TREM2) gene present in hTREM2 _KI mice (Stock No. 038103), resulting in a threonine to lysine mutation (T96K) orthologous to the location of human SNP rs2234253. Human SNP rs2234253 has been associated with an increased risk of Alzheimer's disease (AD). The crRNA, tracrRNA, and CAS9 nuclease were complexed to form an RNP, then introduced into the cytoplasm of hTREM2 _KI-derived zygotes with well recognized pronuclei. Surviving embryos were transferred to pseudopregnant females. Progeny were screened by DNA sequencing to identify correctly targeted hTREM2^T96K pups which were then bred to C57BL/6J mice (Stock No. 000664) for germ line transmission. This colony was backcrossed to C57BL/6J for at least two generations. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Trem2^{em6(TREM2*T96K)Aduci}
Name: endonuclease-mediated mutation 6, Frank LaFerla
MGI accession ID: MGI:8248720
Generation method: Endonuclease-mediated
Attributes: Null/Knockout; Inserted expressed sequence; Humanized sequence
Marker symbol: Trem2
Marker name: triggering receptor expressed on myeloid cells 2
Marker synonyms: AD17; PLOSL2; TREM-2; Trem2a; Trem2b; Trem2c; Trem2-Mia; Trem2-Mib
Chromosome: 17
Strain of origin: C57BL/6J-Trem2^{em3(TREM2)Aduci}/J
Molecular note: A guide RNA (GCACTCTCACCATTACGCTG) was designed to introduce an ACG to AAG missense mutation at position 96 of the human triggering receptor expressed on myeloid cells 2 (TREM2) gene present in Trem2^{em3(TREM2)Aduci} resulting in a threonine to lysine mutation (T96K) orthologous to the location of human SNP rs2234253.