C57BL/6J-Clu^em3Aduci/J

Stock number: 040402
Product name: Clu-rs9331888 (non-risk)
Research areas: Mouse/Human Gene Homologs, Neurobiology Research

Description

Clu-rs9331888 (non-risk) mice model the G allele of the human non-coding rs9331888 SNP within the CLU locus. In humans, this variant is associated with decreased risk of late-onset Alzheimer's disease (LOAD). These mice may be useful in pre-clinical studies of Alzheimer's disease (AD).

Detailed description

Clusterin (CLU), also known as APOJ, has multiple functions including in apoptosis, lipid transport, and complement activity. Altered expression of CLU is a candidate cause for increased late-onset Alzheimer's disease (LOAD) risk. This Clu-rs9331888 (non-risk) allele of mouse clusterin (Clu) models the human non-coding rs9331888 SNP in intron 1 associated with reduced risk of LOAD. These mutations result in a change from the endogenous mouse Clu sequence: CCTGAAAGGG to the human CLU-rs9331888 (non-risk) sequence: TCCAAAGGGA.

Both heterozygous and homozygous mice are viable and fertile. If additional characterization of these Clu-rs9331888 (non-risk) mice is performed, we may modify the strain description accordingly.

The UCI MODEL-AD center has made other Alzheimer's disease models with altered CLU expression available:
Clu-rs9331888 (risk) mice, with the (C) allele of SNP rs9331888, associated with increased risk of LOAD, are available as Stock No. 040401
Clu-KO mice lacking the entire coding region of Clu, and 3'UTR (from Exon 2-9), are available as Stock No. 040403
Clu-h2kbKI mice with a 2kb region of human DNA sequence, including the LOAD risk allele of rs2279590, introduced into the mouse Clu locus are available as Stock No. 037496

Of note, mouse strains have a SNP (rs243559662) within Clu at the orthologous location to human SNP rs9331888, being A in most laboratory strains, but G in SPRET/EiJ, PWK/PhJ, and CAST/EiJ.

Development

Guide RNAs (AATGGGCTTGTCCTCCTGAA and CCGCCCCAGAAAGCCCTTTC) were designed to introduce SNPs found in the human non-coding rs9331888 SNP variant into intron 1 of the mouse clusterin (Clu) locus. These mutations result in a change from the endogenous mouse Clu sequence: CCTGAAAGGG to the human CLU-rs9331888 (risk) sequence: TCCAAAGGGA. The crRNA, tracrRNA and CAS9 nuclease were complexed to form an RNP, then introduced into the cytoplasm of C57BL/6J-derived zygotes with well recognized pronuclei. Surviving embryos were transferred to pseudopregnant females. Progeny were screened by DNA sequencing to identify correctly targeted pups, which were then bred to C57BL/6J mice (Stock No. 000664) for germ line transmission. This Clu-rs9331888 (non-risk) colony was backcrossed to C57BL/6J for a total of at least two generations. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Clu^em3Aduci
Name: endonuclease-mediated mutation 3, Frank LaFerla
MGI accession ID: MGI:8248706
Generation method: Endonuclease-mediated
Attributes: Humanized sequence
Marker symbol: Clu
Marker name: clusterin
Marker synonyms: AAG4; ApoJ; APO-J; Apolipoprotein J; CLI; CLU1; CLU2; complement lysis inhibitor; D14Ucla3; DAG; KUB1; NA1/NA2; RATTRPM2B; Sgp2; SGP-2; SP40; SP-40; Sugp-2; testosterone repressed prostate message-2; TRPM2; TRPM-2; TRPM2B; Trpmb
Chromosome: 14
Strain of origin: C57BL/6J
Molecular note: Guide RNAs (AATGGGCTTGTCCTCCTGAA and CCGCCCCAGAAAGCCCTTTC) were designed to introduce SNPs found in the human non-coding rs9331888 SNP variant into intron 1 of the mouse clusterin (Clu) locus. These mutations result in a change from the endogenous mouse Clu sequence: CCTGAAAGGG to the human CLU-rs9331888 (risk) sequence: TCCAAAGGGA.