NOD/ShiLtJ-Il21^em3Ygch/J

Stock number: 040392
Product name: NOD.Il21^V
Strain synonyms: NOD.Il21^Venus , NOD.Il21-Venus
Research areas: Immunology, Inflammation and Autoimmunity Research, Research Tools

Description

NOD.Il21^V knock-in mice carry an insertion of a Venus fluorescent protein immediately downstream of the stop codon in exon 5 of the Il21 gene. Male and female mice develop type 1 diabetes similar to the NOD/ShiLtJ strain. These mice are useful when studying the development of type 1 diabetes (T1D) and the heterogeneity and disease function of islet-infiltrating IL-21⁺ CD4 T cells in the NOD mouse model of T1D.

Detailed description

NOD.Il21^V knock-in mice carry a CRISPR/Cas9-generated insertion of an IRES sequence followed by a Venus fluorescent protein sequence immediately downstream of the stop codon in exon 5 of the interleukin 21 (Il21) gene. The insertion of the Venus sequence does not affect endogenous gene expression. Il21 encodes an immunoregulatory cytokine, IL-21, important in innate and adaptive immune responses. IL-21-expressing CD4 T cells are present in pancreatic islets where they are essential for type 1 diabetes (T1D) development in the NOD mouse model.

Venus and IL-21 protein expression in NOD.Il21^V mice are largely restricted to CD4 T cells and are present in all examined lymphoid organs and pancreatic islets with the highest frequency found in pancreatic islets. Venus (IL-21)⁺ CD4 T cells sorted from pancreatic islets are highly diabetogenic when adoptively transferred into NOD.Rag1^-/-.NY8.3 recipients, which require help from diabetogenic CD4 T cells to fully exert their diabetogenic activity (PMID: 12498815).

In these mice, Venus fluorescence is detectable by FACS analysis.

Heterozygous mice are viable and fertile. The donating investigator did not attempt to make a homozygous colony. Due to the onset of TID in heterozygotes (and presumably homozygotes), it is suggested that breeders are given Complete Freund's Adjuvant (CFA) prior to six weeks of age to delay diabetes onset, thus extending the lifespan of breeders.

Development

sgRNA (AGGATCTGAGAAGATTCCCG) was used to insert an internal ribosome entry site (IRES) followed by the coding sequence for the yellow fluorescent protein, Venus, immediately downstream of the stop codon in exon 5 of the interleukin 21 (Il21) gene. Guide RNAs and Cas9 nuclease mRNA were introduced into the cytoplasm of zygotes derived from NOD/ShiLtJ mice (Stock No. 001976) with well recognized pronuclei. Correctly targeted embryos were transferred to pseudopregnant females. NOD.Il21^V pups were identified by sequencing and PCR and further backcrossed to NOD/ShiLtJ mice for at least 4 generations to remove potential off-target CRISPR sites. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize NOD/ShiLtJ oocytes.

Allele

Symbol: Il21^em3Ygch
Name: endonuclease-mediated mutation 3, Yi-Guang Chen
MGI accession ID: MGI:7865406
Generation method: Endonuclease-mediated
Attributes: Reporter
Synonyms: Il21^V
Marker symbol: Il21
Marker name: interleukin 21
Marker synonyms: CVID11; IL-21; Za11
Chromosome: 3
Strain of origin: NOD/ShiLtJ
Molecular note: Using the CRISPR/Cas9 system to insert an internal ribosome entry site followed by the coding sequence for the fluorescent protein Venus immediately downstream of the stop codon in exon 5 of the Il21 gene directly in NOD mouse embryos.