C57BL/6J-Trpv4^em1Dhco/J

Stock number: 040352
Product name: Trpv4^p.R594H
Research areas: Cell Biology Research, Developmental Biology Research, Internal/Organ Research, Mouse/Human Gene Homologs, Research Tools

Description

Trpv4^p.R594H mice have an insertion of a loxP flanked cassette containing murine cDNA encoding exons 11-16 of Trpv4 into intron 10 of the endogenous gene. An arginine to histidine (R594H) missense mutation was also created in endogenous exon 11, downstream of the cDNA cassette. When bred to mice that express tissue-specific Cre recombinase, resulting offspring will have the floxed exons 11-16 cDNA deleted and they will express the endogenous gene with the p.R594H mutation in the cre-expressing tissues. These mice may be useful when studying the role of TRPV4 in the onset of skeletal dysplasias and potential therapeutic treatments.

Detailed description

Trpv4^p.R594H conditional knock-in mice carry a CRISPR/Cas9 generated modification that results in the insertion of a loxP flanked cassette containing murine cDNA encoding exons 11-16 of the transient receptor potential cation channel, subfamily V, member 4 (Trpv4) gene, followed by a polyadenylation signal, into intron 10 of the endogenous gene. An arginine to histidine (p.R594H) missense mutation was also created in endogenous exon 11, downstream of the cDNA cassette. Trpv4 encodes a tetrameric, plasma membrane-localized, calcium permeable ion channel expressed in chondrocytes that is involved in the development of bones and cartilage. Expression is also evident in other tissues including bladder, neurons, lung, kidney, liver, bone, muscle, and vascular endothelium. Mutations of TRPV4 are associated with skeletal dysplasias such as spondylometaphyseal dysplasia Kozlowski type (SMDK), metatropic dysplasia, and lethal metatropic dysplasia, all of which exhibit progressive scoliosis along with increasing deformities of the long bones and short stature. p.R594H is the most common SMDK mutation in humans. Mice with a global knock-in of the SMDK p.R594H mutation have an extremely severe skeletal phenotype that is prohibitive of maintaining a live healthy colony.

Mice that are heterozygous for this Trpv4^p.R594H conditional knock-in allele are viable and fertile. When bred to mice that express tissue-specific Cre recombinase, resulting offspring will have the floxed exons 11-16 cDNA cassette deleted and they will express the endogenous gene with the p.R594H mutation in the Cre-expressing tissues.

Breeding to Agc1^cre/ERT2 mice (Stock No. 019148) results in Acan-Cre/Trpv4^p.R594H mice with tamoxifen-inducible selective expression of the p.R594H mutation in chondrocytes. When treated at P21 with tamoxifen, both male and female mice are significantly smaller in size, with shorter limbs and tails, than similarly treated control littermates by 8 weeks of age. They exhibit short limbs, abnormal vertebrae and/or craniofacial abnormalities consistent with the human TRPV4 skeletal dysplasias. They also display abnormal growth plate histology consisting of disorganized proliferating chondrocytes and fewer hypertrophic chondrocytes.

Breeding to Col2a1-Cre (Stock No. 003554), with embryonic Cre expression in chondrocytes starting by E19.5, results in mice with developmental expression of the p.R594H mutation in chondrocytes. These mice exhibit a prenatal onset of abnormal skeletogenesis that is improved by intraperitoneal treatment with the TRPV4-specific inhibitor, GSK279.

Development

Guide RNAs (CAACCGAACGCTGAGACGTC, AACCGAACGCTGAGACGTCA, ACGCGCGGGTTGAAGCTGAC, and CGCGCGGGTTGAAGCTGACG) were designed to target intron 10 of the transient receptor potential cation channel, subfamily V, member 4 (Trpv4) gene for insertion of a loxP flanked cassette containing murine wildtype cDNA encoding exons 11-16 of Trpv4 followed by a polyadenylation signal. An arginine to histidine (R594H) missense mutation was also created in endogenous exon 11 (based on Trpv4-201 ENSMUST00000071968.8). sgRNA, donor plasmid, and the Cas9 RNA were electroporated into embryos from C57BL/6J mice (Stock No. 000664) which were microinjected into blastocysts. Correctly targeted pups were identified by PCR and resulting Trpv4^p.R594H mice were further bred to C57BL/6J mice for one generation to remove off-target CRISPR sites. Sperm was cryopreserved at The Jackson Laboratory. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Trpv4^em1Dhco
Name: endonuclease-mediated mutation 1, Daniel H Cohn
MGI accession ID: MGI:7861782
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed); Humanized sequence
Synonyms: Trpv4(p.R594H)
Marker symbol: Trpv4
Marker name: transient receptor potential cation channel, subfamily V, member 4
Marker synonyms: 0610033B08Rik; BCYM3; CMT2C; HMSN2C; Otrpc4; SMAL; SPSMA; SSQTL1; TRP12; VRL2; VRL-2; VROAC; VR-OAC
Chromosome: 5
Strain of origin: C57BL/6J
Molecular note: A CRISPR/Cas9 generated mutation that results in the insertion of a loxP flanked cassette containing murine cDNA encoding exons 11-16 of Trpv4 into intron 10 of the endogenous gene. An arginine to histidine (R594H) missense mutation was also created in endogenous exon 11, downstream of the cDNA cassette.