C57BL/6J-Spp1^{em1(icre)Gfng}/J

Stock number: 040191
Product name: Spp1-Cre
Research areas: Neurobiology Research, Research Tools

Description

Spp1-Cre knock-in mice are designed to have P2A-icre sequence inserted immediately before the stop codon of the (Spp1) gene. The endogenous Spp1 promoter directs expression of codon-improved Cre recombinase to first-order (FO) thalamic nuclei. These mice are useful for studying thalamic reticular nucleus (TRN) subnetworks and how they regulate thalamocortical interactions and diverse TRN functions, including sensation, action, and cognition.

Detailed description

The Spp1 (secreted phosphoprotein 1, also known as osteopontin) gene encodes a glycoprotein with cytokine-like function originally described in bone that has more recently been identified as a potential neuroprotective target. Spp1 has been associated with microglia-synapse phagocytosis, especially as it relates to Alzheimer's disease (AD). Levels of secreted SPP1 are increased in cerebrospinal fluid and plasma in early AD and are correlated with cognitive decline. It is also a biomarker in some forms of cancer. SPP1 may therefore be of interest to researchers in the fields of bone growth/metabolism, cancer, and neurobiology.

Spp1-Cre knock-in mice are designed to have P2A-icre sequence inserted immediately before the stop codon of the secreted phosphoprotein 1 (Spp1) gene. The presence of P2A-icre cassette allows for expression of Spp1 and codon-improved icre. Heterozygous mice are viable and fertile, the donating investigator has not attempted to make a homozygous colony. When these mice are bred with mice containing loxP-flanked sequence, iCre-mediated recombination will result in deletion of the loxP-flanked sequences in the thalamic reticular nucleus (TRN). TRN is the major inhibitory source of the thalamus, and plays essential roles in sensory processing, attention, and cognition. Spp1 drives expression of iCre in neurons located in the central core of the TRN which project to first-order (FO) thalamic nuclei.

Of note, Ecel1-Cre mice are a similar CRISPR-generated knock-in of a P2A-icre before the stop codon of the endothelin converting enzyme-like 1 (Ecel1) gene and is available as (Stock No. 040192). Ecel1-Cre mice express P2A-iCre in higher-order (HO) thalamic nuclei.

Development

A sgRNAs (TCTGAGGTCAACTAAAGAAG and ACAAGAAAAAGTGTTAGTGA) were used to target sequences immediately before the stop codon of the secreted phosphoprotein 1 (Spp1) gene for insertion of a porcine teschovirus-1 2A oligopeptide (P2A) self-cleaving peptide, to mediate ribosomal skipping, fused to a codon-improved Cre recombinase sequence (icre). sgRNA/tracrRNA duplex gRNA (incorporating crRNA GUUUUAGAGCUAUGCUGUUUUG), single-stranded oligodeoxynucleotides (ssODNs), and the Cas9 nuclease were introduced into the cytoplasm of fertilized eggs with well recognized pronuclei from C57BL/6J mice. Embryos were transferred to pseudopregnant females. Correctly targeted Spp1-Cre pups were identified by PCR and sequencing were further bred to C57BL/6J mice (Stock No. 000664) for at least 10 generations to remove off-target sites. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Spp1^{em1(icre)Gfng}
Name: endonuclease-mediated mutation 1, Guoping Feng
MGI accession ID: MGI:8166495
Generation method: Endonuclease-mediated
Attributes: Recombinase-expressing
Synonyms: Spp1-Cre; Spp1^em1(cre)Gfng
Marker symbol: Spp1
Marker name: secreted phosphoprotein 1
Marker synonyms: 2ar; 44kDa bone phosphoprotein; Apl-1; BNSP; bone sialoprotein 1; BSPI; ETA-1; minopontin; OP; Opn; Opnl; OSP; osteopontin; osteopontin-like protein; Ric; Spp-1
Chromosome: 5
Strain of origin: C57BL/6J
Molecular note: A sgRNAs (TCTGAGGTCAACTAAAGAAG and ACAAGAAAAAGTGTTAGTGA) were used to target sequences immediately before the stop codon of the secreted phosphoprotein 1 (Spp1) gene for insertion of a porcine teschovirus-1 2A oligopeptide (P2A) self-cleaving peptide, to mediate ribosomal skipping, fused to a codon improved Cre (iCre) recombinase sequence (icre).