C57BL/6-Drd1^{em2(flpo)Rcos}/J

Stock number: 040189
Product name: D1-FlpO , Drd1-T2A-FlpO
Research areas: Neurobiology Research, Research Tools

Description

D1-FlpO knock-in expresses optimized Flp recombinase (FlpO) from the mouse Drd1 promoter and enables the targeting of Drd1-expressing cells and the direct pathway spiny projection neuronal (dSPN) subpopulation of neurons in the striatum. This strain is useful in studies of Parkinson's disease.

Detailed description

D1-FlpO mice express optimized Flp recombinase (FlpO) from the mouse Drd1 (dopamine receptor 1) promoter. Expression of the targeted gene is not disrupted by the knock-in mutation. This line can be combined with viral vectors or mouse lines expressing Flp recombinase-dependent constructs to target Drd1-expressing cells and mark the direct pathway spiny projection neuronal subpopulation in striatum. Heterozygous mice demonstrate no overt phenotype and are fertile.

A series of knock-in lines were created by the donating laboratory using a similar targeting strategy to allow direct expression comparisons: A2a-Cre (Stock No. 040186), A2a-FlpO (Stock No. 040187), D1-Cre (Stock No. 040188), and D1-FlpO (Stock No. 040189). The availability of both Cre- and FlpO-expressing alleles controlled from Adora2a (A2a) and Drd1 (dopamine receptor D1) promoters permits the simultaneous but independent examination of both the indirect and direct striatal pathway subpopulations, respectively, during disease progression.

Development

The TGA stop codon in exon 2 of the mouse Drd1 gene (ENSMUST00000021932.5) on mouse Chromosome 13 was replaced with a T2A-FlpO cassette using CRISPR/Cas9 methodologies in C57BL/6N embryos (gRNA: GAGATGAGAACCCAATATTCAGG). Expression of the targeted gene is not disrupted. The donating laboratory reported the resultant mice were backcrossed to C57BL/6J for more than 10 generations prior to sending heterozygous males to The Jackson Laboratory in 2025. Upon arrival, sperm was cryopreserved. To establish a live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).

In 2025, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the first generation rederived living colony at The Jackson Laboratory. All markers were C57BL/6J allele-type.

In 2025, the heterozygous males sent to The Jackson Laboratory were used to freeze sperm. Samples from those males were analyzed via the miniMUGA 10,000 SNP panel. This showed at least 97.6% of the markers consistent with C57BL/6J genetic background.

Allele

Symbol: Drd1^{em2(flpo)Rcos}
Name: endonuclease-mediated mutation 2, Rui Costa
MGI accession ID: MGI:7858928
Generation method: Endonuclease-mediated
Attributes: Recombinase-expressing
Marker symbol: Drd1
Marker name: dopamine receptor D1
Marker synonyms: C030036C15Rik; D1 receptor; D1a; D1R; DADR; Drd-1; DRD1A; Gpcr15
Chromosome: 13
Strain of origin: C57BL/6N
Molecular note: The TGA stop codon in exon 2 of the mouse Drd1 gene on mouse Chromosome 13 was replaced with a T2A-FlpO cassette using CRISPR/cas9 methodologies.