B6;D2-Gt(ROSA)26Sor^{em1(CAG-TBL1XR1/TP63,-EGFP)Mybr}/J

Stock number: 040179
Product name: TgTT
Research areas: Cancer Research, Research Tools

Description

The TgTT transgenic mice express human TBL1XR1/TP63 fusion cDNA and green fluorescent protein (EGFP) under the control of both Cre activation. This mutant mouse strain represents a model that may be useful to study multiple B- and T-cell lymphomas and other human diseases.

Detailed description

The TgTT transgenic mouse is designed to express a human TBL1XR1/TP63 fusion protein cDNA and bicistronically green fluorescent protein (EGFP) under the control of a Cre-activated promoter. The TBL1XR1::TP63 rearrangement, in which the breakpoint is in the WD40 repeat domain of TBL1XR1 and right after the transactivation domain of TP63, is the most common TP63 fusion seen in lymphomas. TP63 fusions are also present in other cancer types (0.02% incidence overall), including lung adenocarcinoma, adenocarcinoma of unknown primary, glioblastoma multiforme, invasive breast carcinoma, and mucosal melanoma of the head and neck. Heterozygous and homozygous mice are viable, normal in size, and do not display any gross physical or behavioral abnormalities before Cre-recombination. When crossed with hCD2-iCre mice (Stock No. 008520), will lead to multiple B- and T cell lymphomas, which mimic the human diseases. This mutant mouse strain serves as a model that may be useful in studies of TBL1XR1/TP63 gene fusion, which leads to tumor progression.

Development

Using CRISPR/Cas9 technology, gRNAs (sgRosa26: ACTCCAGTCTTTCTAGAAGA) were used to insert a CAG promoter, a loxP-flanked neomycin/Stop (specific STOP components?) cassette, human TBL1XR1/TP63 fusion cDNA from the SMZ1 cell line, which contains the fusion gene, IRES, and EGFP into the intron 1 of the Rosa26 locus. TBL1XR1::TP63 cDNA was cloned into a pR26-CAG/GFP-Asc vector (Addgene, #74285). The sgRosa26 and the construct DNA were microinjected with Cas9 enzyme (CP02, PNA-BIO) into the zygote of the B6D2F1 mice, then implanted into pseudopregnant foster mothers. The founder mice with the expected genotype, confirmed by genomic DNA PCR and sequencing, were backcrossed to C57BL/6J mice for at least 5 generations and maintained in the C57BL/6J genetic background by the donating laboratory (see SNP note below). In this system, a loxP-flanked neo gene is expressed under the CAG promoter, and the expression of human TBL1XR1/TP63 fusion cDNA, IRES, and EGFP is blocked. When mated with Cre-expressing mice, the loxP-flanked neo/STOP cassette was removed leading to the expression of the human TBL1XR1/TP63 fusion cDNA and EGFP in tissues of interest. Upon arrival at The Jackson Laboratory, mice were bred to C57BL/6J inbred mice (Stock No. 000664) for at least one generation.



In 2025, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the rederived living colony at The Jackson Laboratory Repository. Many of the 43 markers throughout the genome were segregating with DBA. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed C57BL/6;DBA genetic background.

Allele

Symbol: Gt(ROSA)26Sor^{em1(CAG-TBL1XR1/TP63,-EGFP)Mybr}
Name: endonuclease-mediated mutation 1, Myles Brown
MGI accession ID: MGI:7579420
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed); Reporter; Inserted expressed sequence; Humanized sequence
Synonyms: TgTT
Marker symbol: Gt(ROSA)26Sor
Marker name: gene trap ROSA 26, Philippe Soriano
Marker synonyms: beta geo; Gtrgeo26; Gtrosa26; R26; ROSA26; SETD5-AS1; Thumpd3as1
Chromosome: 6
Strain of origin: (C57BL/6 x DBA/1)F1
Molecular note: CRISPR/Cas9 technology inserted a CAG promoter, a loxP-flanked neomycin/Stop cassette, human TBL1XR1/TP63 fusion cDNA, IRES and EGFP. The TBL1XR1::TP63 rearrangement, in which the breakpoint is in the WD40 repeat domain of TBL1XR1 and right after the transactivation domain of the TP63, is the most common TP63 fusion seen in lymphomas.