STOCK Hmx3^em1Amc Hmx2^em1Amc/J

Stock number: 040112
Product name: Hmx2/Hmx3 KO
Research areas: Cell Biology Research, Research Tools

Description

Hmx2/Hmx3 KO mice have a CRISPR-induced mutation which deletes the entire coding region for the Hmx3 gene and all but a short 3' region of the Hmx2 gene. These mice are useful for studying intercalated cell (IC) subtype diversity in the kidney.

Detailed description

Hmx2/Hmx3 KO mice have a CRISPR-induced mutation which deletes the entire coding region for the H6 homeobox 3 (Hmx3) gene, and all but a short 3' region of the H6 homeobox 2 (Hmx2) gene beyond the predicted DNA binding domain on Chromosome 7. Translation of the mutant Hmx2 allele predicts a non-homologous 110aa protein product. Hmx2 and Hmx3, which have overlapping functions in specific developmental contexts, are separated by 15 kb in the mouse genome. They encode transcription factors involved in the patterning of inner ear structures. HMX2 and HMX3 also act as transcriptional regulators in type B-intercalated cells (B-ICs) and nonA-nonB-ICs (nA/nB-ICs) which act to regulate circulatory pH in the kidney. ICs contribute to acid-base regulation, and sodium, chloride, and potassium homeostasis.

Removal of Hmx2/Hmx3 genes results in IC-subtype switching. At birth, homozygous mice are grossly normal but lack normal development of type B-ICs in the kidney. Homozygous mice are perinatal lethal by P3. Heterozygous mice are viable and fertile with a circling phenotype.

When bred to Dmrt2 KO mice (Stock No. 040115), resulting Dmrt2/Hmx2/Hmx3 triple mutant mice develop hybrid A- and B-/nA/nB-ICs.

Development

Guide RNAs (CGGAGGACUGGGGACCAUGC and AACGGGGAUUCCUUGGGCGC) were designed to delete the entire coding region of the H6 homeobox 3 (Hmx3) gene (based on ENSEMBL Transcript ID: ENSMUST00000046093.6). Also, Guide RNAs (CUCGGGUAAUAAAGCGGAGC and AGUAGUCAAGCUUGUUGUAC) were designed to delete all but a short 3' region of the H6 homeobox 2 (Hmx2) gene (based on ENSEMBL Transcript ID: ENSMUST00000183219.8). Guide RNAs, Cas9 protein, and donor DNA were introduced into the cytoplasm of zygotes derived from C57BL/6J mice. Correctly targeted embryos were transferred to pseudopregnant females. Hmx2/Hmx3 KO pups were identified by Sanger sequencing and PCR and founder mice were further bred to C57BL/6J mice (Stock No. 000664) for 2 generation to develop the colony. It is unknown if any off-target CRISPR changes are present. Subsequently, these mice were bred to mice carrying a Dmrt2 KO allele (see Stock No. 040115). Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J. The Dmrt2 KO allele was removed from this colony of Hmx2/Hmx3 KO and is maintained as a separate strain as Stock No. 040115.

In 2025, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the males sent to The Jackson Laboratory Repository. Five of the 43 markers throughout the genome were segregating with an unknown source.

Allele

Symbol: Hmx2^em1Amc
Name: endonuclease-mediated mutation 1, Andrew P McMahon
MGI accession ID: MGI:8172735
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: Hmx2
Marker name: H6 homeobox 2
Marker synonyms: H6L; Nkx5-2; RGD1565366
Chromosome: 7
Strain of origin: C57BL/6J
Molecular note: Using CRISPR technology, guide RNAs (CUCGGGUAAUAAAGCGGAGC and AGUAGUCAAGCUUGUUGUAC) were designed to delete all but a short 3' region of the H6 homeobox 2 (Hmx2) gene (based on ENSEMBL Transcript ID: ENSMUST00000183219.8). Also, RNAs (CGGAGGACUGGGGACCAUGC and AACGGGGAUUCCUUGGGCGC) were designed to delete the entire coding region of the H6 homeobox 3 (Hmx3) gene (based on ENSEMBL Transcript ID: ENSMUST00000046093.6) to generate Hmx3^em1Amc at the same time.

Allele

Symbol: Hmx3^em1Amc
Name: endonuclease-mediated mutation 1, Andrew P McMahon
MGI accession ID: MGI:8172734
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: Hmx3
Marker name: H6 homeobox 3
Marker synonyms: Nkx5.1; NKX-5.1; Nkx5-1; RGD1559927
Chromosome: 7
Strain of origin: C57BL/6J
Molecular note: Using CRISPR technology, guide RNAs (CGGAGGACUGGGGACCAUGC and AACGGGGAUUCCUUGGGCGC) were designed to delete the entire coding region of the H6 homeobox 3 (Hmx3) gene (based on ENSEMBL Transcript ID: ENSMUST00000046093.6). Also, Guide RNAs (CUCGGGUAAUAAAGCGGAGC and AGUAGUCAAGCUUGUUGUAC) were designed to delete all but a short 3' region of the H6 homeobox 2 (Hmx2) gene (based on ENSEMBL Transcript ID: ENSMUST00000183219.8) to generate Hmx2^em1Amc at the same time.