STOCK En2^em1Alj/J

Stock number: 040093
Product name: En2^HA
Research areas: Research Tools

Description

En2^HA/HA mice have a linker and a 3xHA tag inserted in-frame into the C-terminal of the En2 gene, replacing the endogenous En2 stop codon. This mouse line may be useful when studying the expression of EN2 in excitatory cerebellar nuclei neurons (eCN).

Detailed description

En2^HA/HA mice carry a CRISPR/Cas9 generated insertion of a linker and a 3xHA tag in-frame into the C-terminal of the engrailed 2 (En2) gene, replacing the endogenous stop codon. En2 encodes a homeodomain-containing protein involved in the control of pattern formation during development of the central nervous system. In these En2^HA/HA mice. This includes a subset of cell types in the cerebellum and many cell types in the rest of rhombomere 1 and in the midbrain, and also some jaw muscle precursors.

Homozygous En2^HA/HA mice are viable and fertile.

Development

A single-guide RNA (GGCAAGTCGGACAGCGAGTA) was designed to target the engrailed 2 (En2) gene. Single-stranded oligodeoxynucleotide (ssODN) was designed to insert a linker (GlyLysSerAspSerGlu) and three consecutive HA tags (3xHA) in-frame into the C-terminal of the En2 gene, replacing the endogenous stop codon (based on Ensembl:ENSMUSG00000039095). Cas9, sgRNA, and ssODN were microinjected into the nucleus of derived zygotes with an unknown genetic background. Correctly targeted embryos were transferred to pseudopregnant females. En2^HA pups were identified by sequencing and the resulting colony was maintained by breeding mice onto an outbred Swiss-Webster background by the donating laboratory. No off-target CRISPR changes have been detected. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).

Allele

Symbol: En2^em1Alj
Name: endonuclease-mediated mutation 1, Alexandra L Joyner
MGI accession ID: MGI:7789004
Generation method: Endonuclease-mediated
Attributes: Epitope tag
Synonyms: En2-HA
Marker symbol: En2
Marker name: engrailed 2
Marker synonyms: En-2; RGD1561842
Chromosome: 5
Strain of origin: Not Specified
Molecular note: Using CRISPR technology, a single-stranded oligodeoxynucleotide (ssODN) was designed to insert a linker (GlyLysSerAspSerGlu) and three consecutive HA tags (3xHA) in-frame into the C-terminal of the En2 gene, replacing the endogenous stop codon.