B6(Cg)-Cd8b1^em1Jmlr Tyr^c-2J/JmlrJ

Stock number: 039964
Product name: CD8beta-LSSmOrange
Research areas: Dermatology Research, Mouse/Human Gene Homologs, Research Tools, Sensorineural Research

Description

CD8beta-LSSmOrange knock-in mice have an insertion of a LSSmOrange fluorescent protein sequence into the 3' untranslated region following the termination codon of the Cd8b1 gene. These mice may be useful for fluorescent labeling and imaging of CD8 T cells by intravital microscopy.

Detailed description

CD8beta-LSSmOrange knock-in mice mice have an insertion of an IRES followed by the coding sequence for the large-stokes-shift monomeric orange fluorescent protein sequence (LSSmOrange) into the 3' untranslated region following the termination codon of the CD8 subunit beta 1 (Cd8b1) gene The insertion of the LSSmOrange sequence does not affect endogenous gene expression in heterozygous mice, while homozygous mice exhibit a decrease in the number of CD8-positive cells and level of CD8beta, but not CD8alpha expression. Heterozygous mice demonstrate a normal CD8 T cells response to influenza infection and when crossed to OT-I mice (Stock No. 003831), and show no defect in T cell development or in vitro antigen-specific T cell responses.

CD8beta-LSSmOrange mice are maintained on an albino genetic background to aid in intravital imaging of skin. LSSmOrange fluorescence is detectable in CD8 expressing cells in lymph nodes, spleen, thymus, and lung by direct fluorescent microscopy, flow cytometry, and two photon microscopy.

Homozygous mice are viable and fertile.

Development

sgRNA (CTAGCAGGCTATCAGTGTTG(TGG)) was used to insert an internal ribosome entry site (IRES) followed by the coding sequence for the large-stokes-shift monomeric orange fluorescent protein sequence (LSSmOrange) into the 3' untranslated region following the termination codon of the CD8 subunit beta 1 (Cd8b1) gene (based on Cd8b1-201 ENSMUST00000065248.8). sgRNAs, donor plasmid, and the Cas9 RNA were electroporated into the cytoplasm of C57BL/6J derived embryos with well recognized pronuclei. Targeted embryos were transferred to pseudopregnant females. Correctly targeted pups were identified by PCR and sequencing, and resulting CD8beta-LSSmOrange mice were bred to albino C57BL/6 mice (Stock No. 000058) for at least four generations to remove off-target CRISPR sites and then interbred for five generations by the donating lab to generate a homozygous line. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize oocytes from B6 albino mice.

Allele

Symbol: Tyr^c-2J
Name: albino 2 Jackson
MGI accession ID: MGI:1855985
Generation method: Spontaneous
Attributes: Null/Knockout
Marker symbol: Tyr
Marker name: tyrosinase
Marker synonyms: ATN; CMM8; Oca1; OCA1A; OCAIA; SHEP3; skc35
Chromosome: 7
Strain of origin: B6.Cg-Tyrp1^b Hps1^ep
Site of expression: Expressed in melanosomes
Molecular note: This mutation has a G-to-T base change at coding nucleotide 230 resulting in an amino acid change from arginine to leucine at residue 77 (p.R77L) which lies in the highly conserved DDRE sequence. Nucleotide 230 is at the alternative 5' splice donor site for exon 1 and this allele does not produce the 1a or 1b subset of tyrosinase transcripts but does produce a significant increase in 1c and 1d transcripts. Western blots of homozygous mutant skin extracts demostrate the nearly complete absence of the broad 76-84 kDa band of glycosylated wild-type tyrosinase. No tyrosinase activity was found in hairbulb extracts from homozygous mice.

Allele

Symbol: Cd8b1^em1Jmlr
Name: endonuclease-mediated mutation 1, Jim Miller
MGI accession ID: MGI:7869359
Generation method: Endonuclease-mediated
Attributes: Reporter
Synonyms: CD8-LSSmOrange
Marker symbol: Cd8b1
Marker name: CD8 antigen, beta chain 1
Marker synonyms: CD8B1; CD8beta; CD8BP; LEU2; LY3; Ly-3; Ly-C; LYT3; Lyt-3; P37
Chromosome: 6
Strain of origin: C57BL/6J
Molecular note: sgRNA (CTAGCAGGCTATCAGTGTTG(TGG)) was used to insert an internal ribosome entry site (IRES) followed by the coding sequence for the large-stokes-shift monomeric orange fluorescent protein sequence (LSSmOrange) into the 3' untranslated region following the termination codon of the CD8 subunit beta 1 (Cd8b1) gene.