B6(129P2)-Ddx3x^em1Tdk/J

Stock number: 039888
Product name: Ddx3x^fl
Research areas: Cancer Research, Cell Biology Research, Immunology, Inflammation and Autoimmunity Research, Research Tools

Description

Ddx3x^fl-floxed mice possess loxP sites flanking exons 7-14 of the Ddx3x gene. These mice may be useful for studying the regulatory role of DDX3X in RNA metabolism, cellular stress and innate immune response pathways, as well as embryo development.

Detailed description

The DEAD box helicase 3, X-linked gene (Ddx3x) encodes a conserved DEAD-Box RNA helicase that is important in a variety of cellular processes including transcription, splicing, RNA transport and translation, NLRP3 inflammasome activation and stress granules. The protein is involved in the WNT/β Catenin signaling pathway and is associated with WNT-driven medullablastomas. Mutations in this gene have been associated with multiple cancers as well as intellectual and developmental disabilities. These Ddx3x^fl mice possess loxP sites flanking exons 7-14 of the Ddx3x gene.

Homozygous females and hemizygous males are viable and fertile with no overt phenotype. When bred to mice that express tissue-specific Cre recombinase, resulting offspring will have exons 7-14 deleted in the cre-expressing tissues. The donating laboratory bred these floxed mice to a LysM-Cre (Stock No. 004781) mouse line and resulting Ddx3x^fl/fl LysMCre progeny have macrophages with reduced numbers of stress granules per cell and reduced NLRP3 inflammasome activation in response to inflammatory triggers, such as LPS + nigericin. Also, in response to influenza virus, Ddx3x^fl/fl LysMCre mice have higher levels of influenza virus infection and increased mortality to the infection when compared to controls.

Development

The Ddx3x^fl allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. Guide RNAs (DDX3X-I6-116rc: TTAGCATATGATTACTAAGT and DDX3X-I14-159rc: AGATACTATAAATCGTAGGC) were used to insert loxP sites flanking exons 7-14 of the DEAD box helicase 3, X-linked (Ddx3x) gene on chromosome X. Ddx3 transcript Ddx3x-201 (ENSMUST00000000804.7) was used as reference for the exon number and the guide sequences. The sgRNAs, ssDNA (repair template), and the cas9 nuclease mRNA were introduced into the cytoplasm of zygotes derived from C57BL/6J (Stock No. 000664) mice with well recognized pronuclei. Correctly targeted pups were identified by PCR and sequencing. The resulting Ddx3x^fl mice were backcrossed to C57BL/6J background for at least 3 generations before being bred to LysM-Cre mice (Stock No. 004781) by the donating laboratory. Ddx3x^fl mice provided to The Jackson Laboratory were wildtype for the LysM-Cre allele. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).

Allele

Symbol: Ddx3x^em1Tdk
Name: endonuclease-mediated mutation 1, Thirumala-Devi Kanneganti
MGI accession ID: MGI:6466745
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed)
Synonyms: Ddx3x^fl
Marker symbol: Ddx3x
Marker name: DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3, X-linked
Marker synonyms: CAP-Rf; D1Pas1-rs2; DBX; DDX14; DDX3; DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3, X-linked; embryonic RNA helicase; Fin14; HLP2; MRX102; MRXSSB
Chromosome: X
Strain of origin: C57BL/6J
Molecular note: CRISPR/Cas9 genome editing technology was used to insert loxP sites in introns 6 and 14.