B6;SJL-Gpr4^em3Daba/J

Stock number: 039854
Product name: Gpr4^HA
Research areas: Neurobiology Research

Description

Gpr4^HA/HA mice carry a CRISPR/Cas9 generated HA tag inserted in the C-terminal of the Gpr4 gene. This mouse line may be useful when studying GPR4 effects on retrotrapezoid nucleus (RTN) neuronal activation and CO2-stimulated breathing.

Detailed description

Gpr4^HA/HA mice carry a CRISPR/cas9 generated HA tag inserted in the C-terminal of the G protein-coupled receptor 4 (Gpr4) gene. GPR4 is a proton sensing GPCR with emerging roles in a range of physiological processes, including sensing and initiating responses to tissue acidosis. Pathophysiological states such as inflammation, tumors, ischemia, metabolic, and respiratory disease are commonly accompanied by tissue acidosis. Activation of GPR4 at acid pH stimulates the expression of inflammatory modulators such as chemokines, cytokines, and adhesion molecules, which significantly impacts cellular and humoral immune functions. Both pharmacological and genetic disruption of GPR4 produce broadly anti-inflammatory effects.

In these Gpr4^HA/HA mice, HA immunoreactivity is found in a limited set of brain regions, including in the retrotrapezoid nucleus (RTN), serotonergic raphe nuclei, medial habenula, lateral septum, and several thalamic nuclei. GPR4 expression is not restricted to cells of a specific neurochemical identity as it was observed in excitatory, inhibitory, and aminergic neuronal cell groups. HA immunoreactivity was not detected in brain vascular endothelium.

Homozygous Gpr4^HA/HA mice are viable and fertile. Immunostaining is observed in Gpr4^HA heterozygotes in regions of high expression such as RTN neurons, although the labeling was less intense in neuronal somata and more difficult to discern in neuronal processes when compared to homozygotes.

Development

A single-guide RNA (CATGGGGCTCACTGTGCCGGGGG) was designed to target the G protein-coupled receptor 4 (Gpr4) gene. Single-stranded oligodeoxynucleotide (ssODN; CGTCCGGGGCTGTCTGGGCAGTGCCTCCGACTGCCCAGGGGGACCAGGTGCCACTGAAGGTGCTGCTGCCCCCGGCACAGGGATCCTCAGGTTATCCATACGACGTTCCAGATTACGCTTAGGCCCCATGCCCAACTGTCATCCTGCACCCTTCCGGTTGTATGCAAATGTGTGTAAATATGTCCATGTGAATTACAAG) was designed to insert a hemagglutinin (HA) tag in the C-terminal of Gpr4. The HA tag (YPYDVPDYA-STOP, TATCCATACGACGTTCCAGATTACGCTTAG) was preceded by a Gly-Ser-Ser-Gly (GGATCCTCAGGT) linker based on Gpr4-201 ENSMUST00000060225.6. A ribonucleic protein (RNP) complex was formed by mixing Cas9 with sgRNA, and ssODN and the RNP/ssODN were introduced into the nucleus of B6SJLF1/J-derived zygotes. Correctly targeted embryos were transferred to pseudopregnant females. Gpr4^HA pups were identified by PCR and Sanger sequencing, and founder mice were further backcrossed to C57BL/6J for one generation and then heterozygous offspring were crossed to generate homozygous Gpr4^HA/HA mice. This line has been maintained as homozygotes by further crosses of the progeny for another 5 generations by the donating laboratory. It is unknown if any off-target CRISPR changes are present. Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).

Allele

Symbol: Gpr4^em3Daba
Name: endonuclease-mediated mutation 3, Douglas A Bayliss
MGI accession ID: MGI:7736378
Generation method: Endonuclease-mediated
Attributes: Epitope tag
Synonyms: Gpr4^HA
Marker symbol: Gpr4
Marker name: G protein-coupled receptor 4
Marker synonyms: GPR6C.l; hGPR4
Chromosome: 7
Strain of origin: B6SJLF1/J
Molecular note: CRISPR-assisted genome editing technology was used to insert a hemagglutinin (HA) tag in the C-terminus of Gpr4.