B6.Cg-Gpr4^em1Daba/J

Stock number: 039852
Product name: GPR4(H81F)
Research areas: Neurobiology Research

Description

GPR4(H81F) mice carry a CRISPR/Cas9 generated histidine to phenylalanine mutation at amino acid 81 (H81F) in of the Gpr4 gene. This mouse line may be useful when studying GPR4 effects on retrotrapezoid nucleus (RTN) neuronal activation and CO2-stimulated breathing.

Detailed description

GPR4(H81F) mice carry a CRISPR/Cas9 generated histidine to phenylalanine mutation at amino acid 81 (H81F) of the G protein-coupled receptor 4 (Gpr4) gene. GPR4 is a proton sensing GPCR with emerging roles in a range of physiological processes, including sensing and initiating responses to tissue acidosis. Pathophysiological states such as inflammation, tumors, ischemia, metabolic, and respiratory disease are commonly accompanied by tissue acidosis. Activation of GPR4 at acid pH stimulates the expression of inflammatory modulators such as chemokines, cytokines, and adhesion molecules, which significantly impacts cellular and humoral immune functions. Both pharmacological and genetic disruption of GPR4 produce broadly anti-inflammatory effects.

GPR4(H81F) mice carry a mutation in a pH-sensing histidine residue. Retrotrapezoid nucleus (RTN) neurons provide crucial excitatory drive to respiratory rhythm/pattern generating circuits, and their activity is directly modulated by changes in pH. In these mice, CO2-stimulated breathing and CO2-induced RTN neuronal activation are strongly blunted, with no effect on hypoxia-stimulated breathing.

Homozygous mice are viable and fertile.

Development

A single-guide RNA (GGCCGTGGATCCAGTTGTCATGG) was designed to target the G protein-coupled receptor 4 (Gpr4) gene. Single-stranded oligodeoxynucleotide (ssODN; GTCTACCTGATGAACTTGAGCATTGCAGACCTGCTGTACATCTGCACTTTGCCGCTGTGGGTCGACTACTTCCTCTTTCATGACAACTGGATTCACGGCCCTGGCTCCTGCAAGCTCTTTGGCTTCATCTTCTACAGCAACATCTATATCAGC) was designed to encode CAC to TTT mutations resulting in a histidine to phenylalanine mutation at amino acid 81 (H81F) based on Gpr4-201 ENSMUST00000060225.6. A cytosine to thymidine mutation was also included to disrupt a BamH1 restriction site. sgRNA, ssODN, and the Cas9 mRNA were introduced into the nucleus of B6SJLF1/J-derived zygotes. Correctly targeted embryos were transferred to pseudopregnant females. GPR4(H81F) pups were identified by PCR, restriction digest, and Sanger sequencing, and founder mice were further bred to C57BL/6J for 13 generations by the donating laboratory to develop the colony. It is unknown if any off-target CRISPR changes are present. Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).

Allele

Symbol: Gpr4^em1Daba
Name: endonuclease-mediated mutation 1, Douglas A Bayliss
MGI accession ID: MGI:7736374
Generation method: Endonuclease-mediated
Attributes: Not Applicable
Synonyms: GPR4^H81F; GPR4-H81F
Marker symbol: Gpr4
Marker name: G protein-coupled receptor 4
Marker synonyms: GPR6C.l; hGPR4
Chromosome: 7
Strain of origin: B6SJLF1/J
Molecular note: CRISPR/Cas9 technology was used to introduce H81F (CAC > TTT) point mutations into Gpr4. A cytosine to thymidine mutation was also included to disrupt a BamH1 restriction site.