STOCK Nup107^{em1(DhaA*)Wtd}/J

Stock number: 039823
Product name: Nup107^KI
Strain synonyms: HaloTag-Nup107 , Nup107-Halo
Research areas: Cell Biology Research, Neurobiology Research, Research Tools

Description

Nup107^KI knock-in mice contain a CRISPR/Cas9-generated insertion of a HaloTag immediately upstream of the start codon of the Nup107 gene. These mice are useful when studying neuronal nuclear pore complex (NPC) spatial organization, dynamics, and biogenesis during development.

Detailed description

Nup107^KI knock-in mice contain a CRISPR/Cas9-generated insertion of a HalTag immediately upstream of the start codon of the nucleoporin 107 (Nup107) gene. The Halo-tag does not alter endogenous Nup107 gene expression. Nup107 encodes a protein localized to the nuclear rim that is an essential component of the neuronal nuclear pore complex (NPC). NPCs serve as the gateway between the nucleus and cytoplasm, allowing diffusion of all molecules entering or leaving the nucleus either through passive or active transportation. HaloTag is a 33 kDa haloalkane dehalogenase encoded by the DhaA gene from Rhodococcus rhodochrous that has been mutagenized to form an irreversible covalent bond to synthetic chloroalkane ligands.

When used with the JF646 HaloTag ligand to label endogenous Nup107 protein in DIV10 cortical primary neurons, fluorescent signal colocalized with immunostaining of other nucleoporin components of the nuclear pore complex and increased in a gene dose-dependent manner at the nuclear membrane in neurons. These mice are useful when studying NPC spatial organization, dynamics, and biogenesis during development.

Heterozygous and homozygous mice are viable and fertile.

Development

A sgRNA (gagcgagcgccgagaagacccgg) was designed to insert a HaloTag with a short linker and TEV (tobacco etch virus nuclear-inclusion-a endopeptidase) site immediately upstream of the start codon of the nucleoporin 107 (Nup107) gene (based on Nup107-201 ENSMUSG00000052798). HaloTag is a 33 kDa haloalkane dehalogenase encoded by the DhaA gene from Rhodococcus rhodochrous that has been mutagenized to form an irreversible covalent bond to synthetic chloroalkane ligands. sgRNAs, donor plasmid, and the Cas9 RNA were electroporated into the cytoplasm of C57BL/6J derived embryos with well recognized pronuclei. Targeted embryos were transferred to pseudopregnant females. Correctly targeted pups were identified by PCR, sequencing, and Southern blot, and resulting Nup107^KI mice were bred to C57BL/6J mice for at least 8 generations to remove off-target CRISPR sites by the donating lab (see SNP note below). Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).

In 2024, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the males sent to The Jackson Laboratory Repository. Five of the 43 markers throughout the genome were segregating with an unknown source. Also, 2 of the 5 markers that determine C57BL/6J from C57BL/6N were found to be segregating. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed genetic background.

Allele

Symbol: Nup107^{em1(DhaA*)Wtd}
Name: endonuclease-mediated mutation 1, William T Dauer
MGI accession ID: MGI:7712790
Generation method: Endonuclease-mediated
Attributes: Inserted expressed sequence; Epitope tag
Synonyms: Nup107^KI
Marker symbol: Nup107
Marker name: nucleoporin 107
Marker synonyms: GAMOS7; NPHS11; NUP84; ODG6; ODG6; GAMOS7
Chromosome: 10
Strain of origin: C57BL/6J
Molecular note: A sgRNA (gagcgagcgccgagaagacccgg) was designed to insert a HaloTag with a short linker and TEV (tobacco etch virus nuclear-inclusion-a endopeptidase) site immediately upstream of the start codon of the nucleoporin 107 (Nup107) gene. HaloTag is a 33 kDa haloalkane dehalogenase encoded by the DhaA gene from Rhodococcus rhodochrous that has been mutagenized to form an irreversible covalent bond to synthetic chloroalkane ligands.