NOD/ShiLtJ-Tlr7^em1Dvs/SmliJ

Stock number: 039798
Product name: NOD.Tlr7-/-
Research areas: Diabetes and Obesity Research, Immunology, Inflammation and Autoimmunity Research, Research Tools

Description

These nonobese diabetic (NOD) toll-like receptor 7 (Tlr7) knock-out mice (NOD.Tlr7-/-) may be useful in studies of autoimmunity development. NOD mice spontaneously develop inflammation of lacrimal and salivary glands. In hemizygotes NOD.Tlr7-/y male mice, lacrimal gland inflammation and type 1 diabetes development were specifically prevented.

Detailed description

The nonobese diabetic (NOD) toll-like receptor 7 (Tlr7) knock-out (NOD.Tlr7-/-) mice are gene-edited NOD mice lacking the X-linked Tlr7 expression. The NOD mice are an autoimmune-prone strain of mice that spontaneously develop inflammation of the lacrimal gland in males and inflammation of salivary glands in females. The NOD mice also develop type 1 diabetes (T1D) spontaneously in both sexes. The donating investigators reported that the hemizygous NOD.Tlr7-/y male mice lacking TLR7 were protected from the spontaneous development of lacrimal gland inflammation and T1D, whereas the spontaneous development of salivary gland inflammation and T1D in homozygous NOD.Tlr7-/- females were not protected. The male NOD.Tlr7-/y mice, however, showed increased salivary gland inflammation compared to the Tlr7 wild-type NOD male mice controls. This emphasizes the role of TLR7 in complex disease-promoting and disease-protecting functions depending on the target organs and sex. The hemizygous males and the homozygous females are viable and fertile. However, all genotypes except the hemizygous Tlr7-/y males are prone to develop T1D as found in NOD mice. These NOD.Tlr7-/- mice may be useful in studies of autoimmunity development. These NOD.Tlr7-/y and NOD.Tlr7-/- mice may be useful in studies of the pathogenic development of sex-specific lacrimal gland/salivary gland autoimmunity and T1D.

The Jackson Laboratory has two other Tlr7 knock-in alleles available: the TLR7KI-tdTom knock-in allele with an IRES-tdTomato at the 3' end (Tlr7^tm1.1Gbrt; Stock No. 031827) and the Tlr7 knock-in/knock-out allele with lacZ replacing exon 3 (Tlr7^tm1Flv; Stock No. 008380).

Development

A CRISPR/Cas9-generated mutation was introduced to the second coding exon of the toll-like receptor 7 (Tlr7) gene (gRNA ATTTACAGGTGTTTTCGATG) resulting in a 2 base pair deletion. A solution containing Cas9 mRNA and single guide RNA (sgRNA) was microinjected into NOD/ShiLtJ embryos (Stock No. 001976). The N1 progeny having an allele with a 2 base-pair deletion was backcrossed to NOD/ShiLtJ mice for 1 generation, and the mutation was subsequently fixed to homozygosity and maintained in the NOD/ShiLtJ background by the donating laboratory. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize NOD/ShiLtJ oocytes (Stock No. 001976).

Allele

Symbol: Tlr7^em1Dvs
Name: endonuclease-mediated mutation 1, David V Serreze
MGI accession ID: MGI:7425326
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: Tlr7
Marker name: toll-like receptor 7
Marker synonyms: IMD74; RGD1563357; SLEB17; TLR7-like
Chromosome: X
Strain of origin: NOD/ShiLtJ
Molecular note: CRISPR-targeting of the second coding exon deleted 2 bp.