C57BL/6J-Aqp4^em2Jdd/J

Stock number: 039687
Product name: AllX
Strain synonyms: Aqp4^All_X
Research areas: Cell Biology Research, Neurobiology Research

Description

AllX mice harbor a point mutation (TGA>TGG) which results in the Aqp4 canonical stop codon to become a sense codon, allowing for over-expression of perivascular AQP4 variant (AQP4X). These mice may be useful when studying the glymphatic system, specifically in neurodegenerative diseases such as Alzheimer's disease.

Of note, the donating investigator has also made an NoX mouse model (Stock No. 039686) that does not express any AQP4X in astrocytes.

Detailed description

Aquaporin-4 (AQP4) is a transmembrane channel primarily expressed in the brain and spinal cord and plays a key role in the glymphatic system, which includes regulating interstitial fluid movement, waste clearance, ion homeostasis. Dysfunction of the glymphatic system has been implicated in neuropathologies, such as Alzheimer's disease (AD), making AQP4 a potential therapeutic target. Multiple AQP4 protein variants may be expressed allowing for unique subcellular localizations. Specifically, a read-through extended version (AQP4X) becomes exclusively perivascular within astrocytes, where normal-length AQP4 is localized to parenchyma away from blood vessels.

These AllX mice harbor a point mutation (TGA>TGG) which results in the Aqp4 canonical stop codon to become a sense codon, allowing for over-expression of AQP4X.

Homozygous AllX mice are viable and fertile with no overt phenotype, though the donating laboratory notes that homozygous AllX mice may be slightly smaller in body size compared to wildtype littermates. These AllX mice may be useful for studying the role of perivascular AQP4 in neurodegenerative diseases such as AD.

Of note, the donating investigator has also made an NoX mouse model (Stock No. 039686) that does not express any AQP4X in astrocytes.

Development

The AllX allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. A guide RNA (ATTGTCTTCCGTATGACTAG) was used to insert a TGA-to-TGG mutation, resulting in a stop codon to sense codon, in the aquaporin 4 (Aqp4) gene on chromosome 18. Aqp4 transcript Aqp4-206 (ENSMUST00000234473.2) was used as reference for the exon number and the guide sequences. The sgRNA, ssDNA, and cas9 nuclease mRNA were introduced into the cytoplasm of zygotes derived from C57BL/6J mice with well recognized pronuclei. Correctly targeted pups were identified by PCR and sequencing. The donating investigator reports the resulting AllX mice were backcrossed to C57BL/6J background for at least 5 generations (to reduce off-target events) prior to sending heterozygous males with black coat color to The Jackson Laboratory in 2024. Upon arrival, sperm was cryopreserved. An aliquot of frozen sperm was used to fertilize C57BL/6J (Stock No. 000664) oocytes to establish a live colony.

Allele

Symbol: Aqp4^em2Jdd
Name: endonuclease-mediated mutation 2, Joseph D Dougherty
MGI accession ID: MGI:7703300
Generation method: Endonuclease-mediated
Attributes: Modified isoform(s)
Synonyms: AllX
Marker symbol: Aqp4
Marker name: aquaporin 4
Marker synonyms: AQP-4; aquaporin-4; hAQP4; MIWC; MLC4; WCH4
Chromosome: 18
Strain of origin: C57BL/6J
Molecular note: Using CRISPR/cas9 endonuclease-mediated genome editing, a guide RNA (ATTGTCTTCCGTATGACTAG) was used to insert a TGA-to-TGG mutation, resulting in a stop codon to sense codon, in the aquaporin 4 (Aqp4) gene. Conversion of canonical stop codons to a sense codon results in stop codon readthrough events generating a conserved C-terminally elongated variant of Aquaporin 4 (AQP4X).