C57BL/6J-Aqp4^em1Jdd/J

Stock number: 039686
Product name: NoX
Strain synonyms: Aqp4^No_X
Research areas: Cell Biology Research, Neurobiology Research

Description

NoX mice harbor an insertion of two additional stop codons in-frame downstream of the Aqp4 canonical stop codon. The addition of these extra stop codon sequences results in loss of perivascular AQP4 (AQP4X), while parenchymal AQP4 remains intact. These mice may be useful when studying the glymphatic system, specifically in neurodegenerative diseases such as Alzheimer's disease.

Of note, the donating investigator has also made an AllX mouse model (Stock No. 039687) that overexpresses AQP4X in astrocytes.

Detailed description

Aquaporin-4 (AQP4) is a transmembrane channel primarily expressed in the brain and spinal cord and plays a key role in the glymphatic system, which includes regulating interstitial fluid movement, waste clearance, ion homeostasis. Dysfunction of the glymphatic system has been implicated in neuropathologies, such as Alzheimer's disease (AD), making AQP4 a potential therapeutic target. Multiple AQP4 protein variants may be expressed allowing for unique subcellular localizations. Specifically, a read-through extended version (AQP4X) becomes exclusively perivascular within astrocytes, where normal-length AQP4 is localized to parenchyma away from blood vessels.

These NoX mice harbor an insertion of two additional stop codon sequences in-frame downstream of the Aqp4 canonical stop codon. The addition of these extra stop codons results in loss of AQP4X, while parenchymal AQP4 remains intact.

Homozygous NoX mice are viable and fertile with no overt phenotype. When crossed to APP/PS1 transgenic mice (MMRRC Stock No. 034829), the resulting APP/PS1;Aqp4^No_X progeny showed significantly elevated brain Aβ levels in the interstitial fluid (ISF) compared to control littermates. These NoX mice may be useful for studying the role of perivascular AQP4 in neurodegenerative diseases such as AD.

Of note, the donating investigator has also made an AllX mouse model (Stock No. 039687) that overexpresses AQP4X in astrocytes.

Development

The NoX allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. A guide RNA (ATTGTCTTCCGTATGACTAG) was used to insert two additional stop codon sequences in frame downstream of the canonical stop codon in the aquaporin 4 (Aqp4) gene on chromosome 18. Aqp4 transcript Aqp4-206 (ENSMUST00000234473.2) was used as reference for the exon number and the guide sequences. The sgRNA, ssDNA, and cas9 nuclease mRNA were introduced into the cytoplasm of zygotes derived from C57BL/6J mice with well recognized pronuclei. Correctly targeted pups were identified by PCR and sequencing. The donating investigator reports the resulting NoX mice were backcrossed to C57BL/6J background for at least 5 generations (to reduce off-target events) prior to sending heterozygous males with black coat color to The Jackson Laboratory in 2024. Upon arrival, sperm was cryopreserved. An aliquot of frozen sperm was used to fertilize C57BL/6J (Stock No. 000664) oocytes to establish a live colony.

Allele

Symbol: Aqp4^em1Jdd
Name: endonuclease-mediated mutation 1, Joseph D Dougherty
MGI accession ID: MGI:7703298
Generation method: Endonuclease-mediated
Attributes: No functional change
Synonyms: Aqp4^No_X
Marker symbol: Aqp4
Marker name: aquaporin 4
Marker synonyms: AQP-4; aquaporin-4; hAQP4; MIWC; MLC4; WCH4
Chromosome: 18
Strain of origin: C57BL/6J
Molecular note: Using CRISPR/cas9 endonuclease-mediated genome editing. A guide RNA (ATTGTCTTCCGTATGACTAG) was used to insert two additional stop codon sequences in the frame downstream of the canonical stop codon in the aquaporin 4 (Aqp4) gene. Additional stop codons prevent unusual stop codon readthrough events generating a conserved C-terminally elongated variant of Aquaporin 4 (AQP4X).