B6(Cg)-App^em2Aduci/J

Stock number: 039631
Product name: hAbeta-Swe-Ibe-loxP-KI
Research areas: Mouse/Human Gene Homologs, Neurobiology Research

Description

The hAbeta-Swe-Ibe-loxP-KI knock-in mouse model of Alzheimer's disease carries humanizing Aβ region R684H, F681Y, and G676R mutations, and the KM670/671NL (Swedish) mutation in exon 16, as well as the I716F (Iberian) mutation in exon 17. They also have loxP sites flanking exon 16. This strain may be useful for studying late-onset Alzheimer's disease.

Detailed description

The hAbeta-Swe-Ibe-loxP-KI knock-in mouse model of Alzheimer's disease carries humanizing Aβ region R684H, F681Y, and G676R mutations, and the KM670/671NL (Swedish) mutation in exon 16, as well as the I716F (Iberian) mutation in exon 17. They also have loxP sites flanking exon 16. Long-read RNA-sequence analysis of brains from this mouse line supports that the hAbeta-Swe-loxP-KI allele is transcribed at a level similar to the wild-type App allele, with no evidence of cryptic splicing products. Compared to the hAbeta-loxP-KI allele in the parental strain (Stock No. 031050), this hAbeta-Swe-loxP-KI allele is expected to produce more Abeta peptide due to increased cleavage of APP by beta-secretase, and an increased Abeta 42/40 ratio. This strain may be useful for studying late-onset Alzheimer's disease.

Important note about App isoforms and exon numbering:The App-201 isoform (695 aa protein) is encoded by 16 exons, of which the Abeta sequence is encoded by exon 14. The App-206 isoform (770 aa protein) is encoded by 18 exons, of which the Abeta sequence is encoded by exon 16.

Development

A guide RNA (CACCAGGGTGATGACAATCA) was designed to produce the I716F (Iberian) mutation in exon 17 of the amyloid beta precursor protein (App) gene. App transcript App-206 (ENSMUSE00000131684) was utilized as reference for the exon number and guide sequences. Specifically, the mutations change an isoleucine (I) to phenylalanine (F) in APP. The crRNA, tracrRNA, CAS9 nuclease, and ssODN were complexed to form an RNP, then introduced into the cytoplasm of zygotes derived from hAbeta-Swe-loxP-KI mice (Stock No. 039630) with well recognized pronuclei. The hAbeta-Swe-loxP-KI "humanized" App knock-in strain has 3 point mutations in the App gene (R684H, F681Y, and G676R) and the KM670/671NL (Swedish) mutation in exon 16, and also have loxP sites flanking exon 16. Surviving embryos were transferred to pseudopregnant females. Progeny were screened by DNA sequencing to identify correctly targeted pups, which were then bred to C57BL/6J mice (Stock No. 000664) for germ line transmission. Transmission of the hAbeta-Swe-Ibe-loxP-KI allele was confirmed by DNA sequencing of N1 heterozygous mice. This hAbeta-Swe-Ibe-loxP-KI colony was backcrossed to C57BL/6J for a total of at least two generations. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: App^em2Aduci
Name: endonuclease-mediated mutation 2, Frank LaFerla
MGI accession ID: MGI:7645731
Generation method: Endonuclease-mediated
Attributes: Humanized sequence
Marker symbol: App
Marker name: amyloid beta (A4) precursor protein
Marker synonyms: AAA; Abeta; ABPP; AD1; Adap; alpha-sAPP; APPI; appican; betaAPP; CTFgamma; Cvap; E030013M08Rik; PN2; PN-II; preA4; protease nexin II
Chromosome: 16
Strain of origin: B6(Cg)-App^em1Aduci/J
Molecular note: A guide RNA (CACCAGGGTGATGACAATCA) was designed to produce the I716F (Iberian) mutation in exon 17 of the amyloid beta precursor protein (App) gene. Specifically, the mutations change an isoleucine (I) to phenylalanine (F) in APP. This targetted mutation was made in App zygote containing a loxP site upstream of exon 14, 3 point mutations inserted into exon 14 to create amino acid substitutions (amino acids 5 (G->R), 10 (F->Y) and 13 (R->H)) (ENSMUSE00000131684), a loxP site downstream of exon 14 and the KM670/671NL (Swedish) mutations in exon 16 of the amyloid beta precursor protein (App) gene.