C57BL/6J-Ckb^em1Nnb/OrbnJ

Stock number: 039571
Product name: Ckb^tm1Nnb
Strain synonyms: Ckb knock-out
Research areas: Cell Biology Research, Metabolism Research, Research Tools

Description

These Ckb knock-out mice ("Ckb^tm1Nnb") have two CRISPR induced 5' mutations in the Ckb gene resulting in a new 3' splice site and a new out-of-frame start codon. These mice are useful for studying adipocyte thermogenesis, energy homeostasis, and in therapeutic drug activation studies.

Detailed description

These Ckb knock-out mice ("Ckb^tm1Nnb") have two CRISPR induced 5' mutations in the creatine kinase, brain (Ckb) gene resulting in a new 3' splice site and a new out-of-frame start codon. Ckb encodes a cytoplasmic enzyme expressed in brown and beige adipose tissue where it is involved in energy homeostasis. It is also a key effector of the creatine/phosphocreatine cycle which is involved in adaptive thermogenesis and plays a role in regulating fluctuating energy demands in tissues such as muscle and brain. Dysregulation of Ckb has been associated with the onset of metabolic diseases as well as Alzheimer's and Huntington's diseases, and cancer metastases.

Importantly, CKB is also able to phosphorylate tenofovir-monophosphate, forming tenofovir-diphosphate (TVF-DP), the pharmacologically active metabolite of disoproxil fumarate (TDF) and tenofovir alafenamide. These orally administrable prodrugs are approved for the treatment and prevention of human immunodeficiency virus (HIV) infection and the treatment of chronic hepatitis B virus (HBV) infection. Phosphorylation of these drugs results in the formation of tenofovir-diphosphate (TFV-DP), the pharmacologically active metabolite.

Brain lysates from Ckb^tm1Nnb male and female mice form 70.5 and 77.4% less TFV-DP than wild-type brain lysates of the same sex, respectively. Also, males treated with TDF for 14 days exhibit a 22.8% reduction in TFV activation in the liver compared to wild-type male mice.

Homozygous mice are viable and fertile. However, homozygous crosses result in statistically more female pups (>60%). Aged mice display cognitive deficits, as shown by the Y-maze and Novel Object Recognition tests.

Development

Guide RNAs (GCGGGCUGCAGGGAAGAGCGUUUUAGAGCUAUGCU and CGUGCCAAGUGCACGCCGAGGUUUUAGAGCUAUGCU) were designed to flank the start codon of the creatine kinase, brain (Ckb) gene (based on Ckb-201 ENSMUST00000001304.9). Guide RNAs, Cas9 protein, and donor DNA were introduced into the cytoplasm of zygotes derived from C57BL/6J mice. Correctly targeted embryos were transferred to pseudopregnant females. One male founder was identified by Sanger sequencing and PCR to have a 55 bp and a 28 bp deletion. These deletions resulted in a new 3' splice site, a new out-of-frame start codon, and the absence of any mutation-induced alternative splicing. This allele was isolated by backcrossing once to a female C57BL/6J mouse (Stock No. 000664) and resulting heterozygote offspring were crossed. Homozygous offspring were then crossed to develop this Ckb knock-out mouse line referred to as "Ckb^tm1Nnb" in the primary reference. The genetic background has since been refreshed by backcrossing to both male and female C57BL/6J mice. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Ckb^em1Nnb
Name: endonuclease-mediated mutation 1, Namandje N Bumpus
MGI accession ID: MGI:7646843
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Synonyms: Ckb^tm1Nnb
Marker symbol: Ckb
Marker name: creatine kinase, brain
Marker synonyms: BCK; B-CK; Ck-3; Ckbb; Ckbr; CPK-B; HEL-211; HEL-S-29
Chromosome: 12
Strain of origin: C57BL/6J
Molecular note: CRISPR/Cas9 was used to target the start codon of the Ckb gene, which resulted in two mutations on the same allele, a 55 base pair deletion that spanned 12 base pairs of intron 1 and 43 base pairs of exon 2, including the start codon, and a 28 base pair deletion beginning 134 base pairs into exon 2. These deletions resulted in a new 3' splice site, a new out-of-frame start codon, and the absence of any mutation-induced alternative splicing. Although significantly lower mRNA was detected by PCR in the brain, the total protein knockout was confirmed in brain lysates by immunoblot using an antibody specific to the C-terminus.