B6.Cg-Hyls1^em1Ahol/J

Stock number: 039570
Product name: Hyls1^DG
Strain synonyms: Hyls1 D226G
Research areas: Cell Biology Research, Developmental Biology Research

Description

Hyls1^Dg mice carry a point mutation (D226G) in the Hyls1 gene, corresponding to the human D211G mutation. These mice may be useful for studying Hydrolethalus Syndrome (HLS).

Detailed description

Hyls1 encodes a protein localized to the centrosome and plays a role in ciliogenesis as well we centriole biogenesis and stability. In humans, the D211G mutation is known to cause Hydrolethalus Syndrome (HLS) which is characterized by developmental defects (polydactyly, hydrocephaly, and cleft lip or palate) that lead to lethality around birth. These Hyls1^DG mice harbor a CRISPR-mediated point mutation (GAC>GGT) that results in an amino acid substitution from an aspartic acid to a glycine (D226G), which corresponds to the human D211G clinical mutation.

Heterozygous Hyls1^DG are viable and fertile with no overt phenotype. Homozygous mice are perinatal lethal and demonstrate polydactyly, a cleft palate, breathing abnormalities as well as reduced kidney size. Histological analysis of the kidneys from homozygous mice reveals small cysts, dilated tubules, and increased fibrosis. Ultrastructure expansion microscopy also shows significant centriole structural defects in several tissues of homozygous mice. Hyls1^DG mice may be useful for studying centriole and cilia pathology in diseases such as HLS.

Development

The Hyls1^DG allele was generated using CRISPR/Cas9 endonuclease-mediated homology-directed repair (HDR) genome editing. A single guide RNA [5'-CTACTCGGTCTATCTTGCCC-3'] was used to introduce a GAC>GGT point mutation in exon 3 of the HYLS1, centriolar and ciliogenesis associated (Hyls1) gene on chromosome 9. The guide RNA, donor sequence (5'- CAGTCTCTTTTGTACTCAAAATATCTGGCTACTCGACCCATTTTTCCCCGGTTTCGGCTTAACTGATCCAGTCTGGGGAG-3') and Cas9 nuclease were introduced into B6SJLF2 zygotes and transferred to pseudopregnant females. Correctly targeted pups were identified by PCR and sequencing. The resulting heterozygous Hyls1^DG mice were backcrossed to C57BL/6 mice for at least 7 generations by the donating laboratory. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).

Allele

Symbol: Hyls1^em1Ahol
Name: endonuclease-mediated mutation 1, Andrew Holland
MGI accession ID: MGI:7647196
Generation method: Endonuclease-mediated
Attributes: Humanized sequence
Synonyms: Hyls1^DG
Marker symbol: Hyls1
Marker name: HYLS1, centriolar and ciliogenesis associated
Marker synonyms: 3010015K02Rik; HLS; hydrolethalus syndrome 1
Chromosome: 9
Strain of origin: (C57BL/6 x SJL)F2
Molecular note: The Hyls1(DG) allele was generated using CRISPR/Cas9 endonuclease-mediated homology-directed repair (HDR) genome editing. A single guide RNA [5'-CTACTCGGTCTATCTTGCCC-3'] was used to introduce a GAC-GGT point mutation in exon 3 of the HYLS1, centriolar, and ciliogenesis associated (Hyls1) gene on chromosome 9. The mutation recapitulates features of the Hydrolethalus syndrome, an autosomal recessive ciliopathy caused by a mutation that leads to a change from an aspartic acid to a glycine in the amino acid 211 in humans.