C57BL/6J-Drd1^{em1(flpo)Nryn}/J

Stock number: 039507
Product name: Drd1-Flpo
Research areas: Neurobiology Research, Research Tools

Description

Drd1-Flpo knock-in mice are designed to have P2A-flpo sequence inserted immediately upstream of the stop codon in exon 2 of the Drd1 gene. The endogenous Drd1 promoter/enhancer regions direct expression of optimized flpo recombinase to D1DR+ neurons in brain areas including the striatum, frontal cortex, and cerebellum. These mice are useful as a tool for investigating the diverse roles of D1DR+ neurons and their subpopulations in brain disease.

Detailed description

Drd1 encodes a D1-type dopamine receptor which is the most abundant dopamine receptor in the brain. It is involved in the regulation of neuronal growth and development, and also mediates some behavioral responses.

Drd1-Flpo knock-in mice are designed to have P2A-flpo sequence inserted immediately upstream of the stop codon in exon 2 of the dopamine receptor D1 (Drd1) gene. The presence of P2A-flpo cassette downstream of the Drd1 coding region allows for expression of DRD1 and FLPO. Heterozygous mice are viable and fertile. The donating investigator did not make a homozygous colony. When these mice are bred with mice containing FRT-flanked sequence, flpo-mediated recombination will result in deletion of the FRT-flanked sequences in flpo-expressing cells. These mice are useful as a tool for investigating the diverse roles of D1DR+ neurons and their subpopulations in brain disease.

Development

A sgRNA (GGTTGAATGCTGTCCGCTGT) was used to insert a viral 2A oligopeptide (P2A) self cleaving peptide, to mediate ribosomal skipping, fused to a flpo recombinase sequence (flpo) at 2901 bp in the dopamine receptor D1 (Drd1) gene, immediately upstream of the stop codon in exon 2. sgRNA, single-stranded DNA (ssDNA), and Cr:tracr:Cas9 RNP complexes were introduced into the cytoplasm of fertilized eggs with well recognized pronuclei from C57BL/6J mice. Targeted embryos were transferred to pseudopregnant CD-1 females. Correctly targeted Drd1-Flpo pups were identified by PCR and were further bred to C57BL/6J mice for at least 4 generations. It is unknown if any off-target CRISPR sites are present. Upon arrival at The Jackson Laboratory in 2024, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).

Allele

Symbol: Drd1^{em1(flpo)Nryn}
Name: endonuclease-mediated mutation 1, Nandakumar Narayanan
MGI accession ID: MGI:7703312
Generation method: Endonuclease-mediated
Attributes: Recombinase-expressing
Marker symbol: Drd1
Marker name: dopamine receptor D1
Marker synonyms: C030036C15Rik; D1 receptor; D1a; D1R; DADR; Drd-1; DRD1A; Gpcr15
Chromosome: 13
Strain of origin: C57BL/6J
Molecular note: A sgRNA (GGTTGAATGCTGTCCGCTGT) was used to insert a viral 2A oligopeptide (P2A) self cleaving peptide, to mediate ribosomal skipping, fused to a flpo recombinase sequence (flpo) at 2901 bp in the dopamine receptor D1 (Drd1) gene, immediately upstream of the stop codon in exon 2.