B6(Cg)-Trac^{em2(Tcrb,Tcra)Strom} Msln^em2Strom/J

Stock number: 039444
Product name: 7431 Msln^-
Research areas: Research Tools

Description

7431 Msln^- mice express low affinity mesothelin (Msln)-specific T cell receptor (TCR) from the mouse T cell receptor alpha constant (Trac) locus in combination with a knock-out of the endogenous Msln gene. This strain demonstrates T cell receptor exchange (TRex), an improved alternative to traditional transgenic methodologies that enables robust and efficient TCR expression from the targeted environment of the endogenous Trac locus. Expression from Trac confers resistance to T cell functional loss and increases TCR avidity while preserving physiologic T cell development. This strain is useful in studies of T cell-directed cancer therapies.

Detailed description

Mesothelin (Msln) is a self-antigen overexpressed in many malignancies and a promising target for T cell-directed cancer therapies. 7431 Msln^- mice express Msln-specific T cell receptor (TCR) from the mouse T cell receptor alpha constant (Trac) locus in combination with a knock-out of the endogenous Msln gene to circumvent T cell tolerance. The Vα4 and Vβ9 TCR demonstrates low affinity for the Msln_406-414:H-2D^b epitope. Trac targeting improves functional sensitivity of this lower affinity TCR and confers resistance to T cell functional loss while preserving physiologic T cell development.

This strain demonstrates T cell receptor exchange (TRex), an improved alternative to traditional transgenic methodologies that enables robust and efficient TCR expression from the environment of the endogenous Trac locus. Expression from Trac confers resistance to T cell functional loss and increases TCR avidity while preserving physiologic T cell development.

A similar TCR model demonstrating a higher affinity for the Msln_406-414:H-2D^b epitope is also available (see Stock No. 039279). TCRs in both the higher (Stock No. 039279) and lower (Stock No. 039444) affinity strains utilize Vα4 and Vβ9 and differ only in the CDR3 sequences within the chains, which largely contribute to TCR specificity.

Development

CRISPR-READI (CRISPR RNP Electroporation and AAV Donor Infection) methodologies were applied to introduce an in-frame, lower affinity (clone 7431), codon optimized, Msln_406-414:H-2D^b-specific Vα4/Vβ9 T cell receptor (TCR) to exon 1 of the mouse Trac gene and simultaneously delete 23 bp from the 5’ end of exon 4 of the endogenous Msln gene to create a knock-out allele.

TCR clone 7431 TCRβ variable (V), TCRβ constant (C) and TCRα V, linked by a self-cleaving P2A element and flanked by homology arms (HA) encoding endogenous Trac genomic sequences were introduced to C57BL/6J embryos through adenoviral vector (AAV) rAAV6. SgRNAs recognizing exon 1 of Trac (UUCUGGGUUCUGGAUGUCUG; −54220521; ENSMUST00000198398) and exon 4 of Msln (GGCCAAGAAAGAGGCCUGUG; +25753054; ENSMUST00000238120) were used in conjunction with Cas9 protein as ribonucleoprotein (RNP) complexes in the electroporation step. Resultant mice were maintained on a C57BL/6J genetic background by the donating laboratory (see SNP note below). Upon arrival, sperm was cryopreserved. To establish a live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).

A similar TCR model demonstrating a higher affinity for the the Msln_406-414:H-2D^b epitope is also available (see Stock No. 039279). TCRs in both the higher (Stock No. 039279) and lower (Stock No. 039444) affinity strains utilize Vα4 and Vβ9 and differ only in the CDR3 sequences within the chains, which largely contribute to TCR specificity.

In 2024, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the rederived living colony at The Jackson Laboratory Repository. Two of the 43 markers throughout the genome were segregating with an uknown source. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed genetic background.

Allele

Symbol: Trac^{em2(Tcrb,Tcra)Strom}
Name: endonuclease-mediated mutation 2, Ingunn Stromnes
MGI accession ID: MGI:7645419
Generation method: Not Applicable
Attributes: Null/Knockout; Inserted expressed sequence
Synonyms: 7431 TRex
Marker symbol: Trac
Marker name: T cell receptor alpha constant
Marker synonyms: Gm16914; IMD7; TCRA; Tcra-C; TRA@; TRCA
Chromosome: 14
Strain of origin: C57BL/6J
Molecular note: CRISPR technology was used to introduce an in-frame, low affinity (clone 7431), codon-optimized, Msln406-414:H-2Db-specific Valpha4/Vbeta9 T cell receptor (TCR) clone 7431 consisting of TCRb variable (V), TCRb constant (C) and TCRa V, linked by a self-cleaving P2A element to exon 1 of the mouse Trac gene and simultaneously delete 23 bp from the 5' end of exon 4 of the endogenous Msln gene to create a knock-out allele.

Allele

Symbol: Msln^em2Strom
Name: endonuclease-mediated mutation 2, Ingunn Stromnes
MGI accession ID: MGI:7645424
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Synonyms: Msln^-
Marker symbol: Msln
Marker name: mesothelin
Marker synonyms: C-ERC; megakaryocyte potentiating factor; MPF; SMRP
Chromosome: 17
Strain of origin: C57BL/6J
Molecular note: Using CRISPR/Cas9 technology, SgRNAs recognizing exon 4 of Msln (GGCCAAGAAAGAGGCCUGUG; +25753054; ENSMUST00000238120) were targetted result in Msln indel causing disruption.