C57BL/6NJ-Gt(ROSA)26Sor^em22Arz/J

Stock number: 039420
Product name: B6N.Bxb1v2
Strain synonyms: B6N.RosaBxb-GT/GA
Research areas: Research Tools

Description

B6N.Bxb1v2 mice are a resource for the rapid creation of vector-free targeted alleles in the Gt(ROSA)26Sor locus on the C57BL/6NJ background. The dual Bxb1 attP-site "safe harbor landing pad" in the first intron of Gt(ROSA)26Sor enables efficient and precise integration of a donor DNA sequence by recombinase mediated cassette exchange (RMCE), and the vector backbone sequence is simultaneously excluded.

Of note: The Bxb-GT/GA dual landing pad platform is available on the C57BL/6J congenic background as Stock No. 036152, on the C57BL/6NJ congenic background as Stock No. 039420, on a B6 albino background as Stock No. 036153, on the NSG as Stock No. 036151, and on the NOD/ShiLtJ background as Stock No. 036181.

Detailed description

B6N.Bxb1v2 mice have the dual Bxb1 attP-site "safe harbor landing pad" in the first intron of Gt(ROSA)26Sor. This is designed to allow site-specific and precise insertion of a donor DNA sequence that is free from vector sequence, does not require the use of homology arms and integrates as a single copy at high efficiency.

This B6N.Bxb1v2 dual landing pad allele utilizes heterologous attachment sites (attP-GT and attP-GA) which increases the integration efficiency as much as 3-fold over that observed using a single attachment site. [Low et al., 2022]

In practice, a donor DNA vector is prepared containing the corresponding Bxb1 attB sites flanking up to or greater than ~40kb of desired DNA sequence (e.g., Addgene plasmids 175390 or 175391). The donor plasmid is then delivered along with the Bxb1 integrase (mRNA or protein) into the pronucleus of fertilized oocytes from this B6N.Bxb1v2 strain for recombinase mediated cassette exchange (RMCE). This is designed to result in highly efficient unidirectional, single-copy integration of the donor sequence into the Gt(ROSA)26Sor locus in up to ~50% of offspring. The inserted sequence will be flanked by the recombined attachment sites, now called Bxb1 attR-(GT) and Bxb1 attL-(GA), but will be otherwise scar-less (free from residual vector sequence from the plasmid backbone). [Low et al., 2022]

Both heterozygous and homozygous mice are viable and fertile with normal breeding, and no reported gross phenotypic or behavioral abnormalities.

Of note: The Bxb-GT/GA dual landing pad platform is available on the C57BL/6J congenic background as Stock No. 036152, on the C57BL/6NJ congenic background as Stock No. 039420, on a B6 albino background as Stock No. 036153, on the NSG as Stock No. 036151, and on the NOD/ShiLtJ background as Stock No. 036181.

Development

The B6N.Bxb1v2 allele was generated in the laboratory of Dr. Aamir Zuberi (The Jackson Laboratory) using CRISPR/Cas9 endonuclease-mediated genome editing/oligo-mediated homology directed repair. First, sgRNAs (ACTCCAGTCTTTCTAGAAGA and CTCCAGTCTTTCTAGAAGAT) were selected to target intron 1 of the Gt(ROSA)26Sor locus on Chromosome 6 and a long single stranded (lss) DNA donor was used to integrate the Bxb1 attP-GT site into the resulting dsDNA break. These reagents were introduced into C57BL/6NJ zygotes (Stock No. 005304) and, after an initial backcross to C57BL/6NJ, the resulting progeny were intercrossed to generate homozygous embryos which were targeted again to insert a second heterologous Bxb1 attP-GA site. The attP-GA sequence was delivered as a lssDNA oligonucleotide donor along with Cas9 and sgRNAs CCTCGGAGTATTTTCCATCG, and ATGTCTTTAATCTACCTCGA) to position this site 240bp 3' of the first site. The end result is a 48 bp Bxb1 attP-GT sequence and a 48 bp Bxb1 attP-GA sequence separated by a 240 bp spacer of native Gt(ROSA)26Sor sequence.

Microinjected embryos were transferred into pseudopregnant females and progeny were screened by PCR to identify correctly targeted pups. A single founder mouse was backcrossed to C57BL/6NJ mice for germline transmission and the verified offspring were interbred to establish a homozygous colony. After re-targeting to add the second site, a single founder mouse was again backcrossed to C57BL/6NJ mice for germline transmission and the resulting offspring were interbred. The resulting mice were maintained as homozygotes before being sent to The Jackson Laboratory Repository in 2024 as Stock No. 039420.

Allele

Symbol: Gt(ROSA)26Sor^em22Arz
Name: endonuclease-mediated mutation 22, Aamir Zuberi
MGI accession ID: MGI:8262940
Generation method: Endonuclease-mediated
Attributes: RMCE-ready
Marker symbol: Gt(ROSA)26Sor
Marker name: gene trap ROSA 26, Philippe Soriano
Marker synonyms: beta geo; Gtrgeo26; Gtrosa26; R26; ROSA26; SETD5-AS1; Thumpd3as1
Chromosome: 6
Strain of origin: C57BL/6NJ
Molecular note: Using CRISPR/Cas9 endonuclease-mediated genome editing/oligo-mediated homology directed repair. First, sgRNAs (ACTCCAGTCTTTCTAGAAGA and CTCCAGTCTTTCTAGAAGAT) were selected to target intron 1 of the Gt(ROSA)26Sor locus on Chromosome 6 and a long single stranded (lss) DNA donor was used to integrate the Bxb1 attB-GT site into the resulting dsDNA break.