B6.Cg-Klf1^{em1(icre)Jbkr}/J

Stock number: 039341
Product name: EKLF-CRE
Research areas: Developmental Biology Research, Hematological Research, Research Tools

Description

EKLF-CRE CRISPR-derived knock-in mice are designed to have T2A self-cleaving peptide fused to an iCre sequence inserted in-frame into the C-terminal of the Klf1 gene. The endogenous Klf1 promoter directs expression of iCre recombinase to tissues in the early developing embryo as well as in adult bone marrow. These mice are useful for studying and tracing the maturation of erythroid cells.

Detailed description

EKLF-CRE CRISPR-derived knock-in mice are designed to have T2A self-cleaving peptide fused to an icre sequence inserted in-frame into the C-terminal of the Kruppel-like transcription factor 1 (Klf1) gene. Also known as EKLF, KLF1 is a hematopoietic-specific transcription factor that is critical in all aspects of erythropoiesis. Eklf mRNA first appears at the neural plate stage, localized to the earliest morphologically identified erythroid cells in the blood islands of the yolk sac. By E9.5, expression is evident in the fetal liver, and then in the adult bone marrow and splenic red pulp. During hematopoiesis, its levels are highest in the common myeloid and megakaryocyte/erythroid progenitors, after which it remains elevated only in the erythroid cell.

The presence of T2A-icre cassette allows for expression of both Eklf and icre in these mice, which is consistent with endogenous Eklf expression. Homozygous mice are viable and fertile. When these mice are bred with mice containing loxP-flanked sequence, Cre-mediated recombination will result in deletion of the loxP-flanked sequences in Cre-expressing cells. These mice are useful for studying and tracing the maturation of erythroid cells.

Development

sgRNA (based on ATCTTTTGGGATACGGTCCT) was designed to insert a T2A self-cleaving peptide sequence, flanked by linkers, followed by a codon improved icre sequence into the C-terminal of the Kruppel-like transcription factor 1 (Klf1) gene fused in-frame to the final leucine amino acid (based on ENSMUSG00000054191). sgRNA, the cas9 protein, and a donor plasmid were introduced into the cytoplasm of fertilized eggs with well-recognized pronuclei derived from mating superovulated B6D2 females with C57BL/6J males. Injected embryos were transferred to pseudopregnant females. The donating laboratory reported the resulting EKLF-CRE mice were screened by tail PCR and mice with correct targeting were further bred to C57BL/6J mice for at least six generations (to limit off-target CRISPR sites) prior to sending males to The Jackson Laboratory in 2024 (see SNP results). If rederiving a live colony, we will use an aliquot of frozen sperm to fertilize C57BL/6NJ oocytes (Stock No. 005304).

In 2024, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the males sent to The Jackson Laboratory Repository. 42/43 markers throughout the genome suggested a C57BL/6 genetic background, the exception being one marker on chromosome 8 [~110 Mbp] was heterozygous for C57BL/6 and other. Additionally, 4 of 5 markers that determine C57BL/6J from C57BL/6N were found to be homozygous C57BL/6N allele-type (chromosomes 1 [~139 Mbp], 6 [~108 Mbp], 8 [~58 Mbp], 15 [~57 Mbp]) with 1 of 5 as heterozygous C57BL/6N allele-type (chromosome 19 [~50 Mbp]). These data suggest that the mice sent to The Jackson Laboratory were on a mixed C57BL/6J;C57BL/6N genetic background (majority C57BL/6N) with some other genomic contribution on distal chromosome 8.

Allele

Symbol: Klf1^{em1(icre)Jbkr}
Name: endonuclease-mediated mutation 1, James J Bieker
MGI accession ID: MGI:7616745
Generation method: Endonuclease-mediated
Attributes: Recombinase-expressing
Synonyms: EKLF-CRE
Marker symbol: Klf1
Marker name: Kruppel-like factor 1 (erythroid)
Marker synonyms: CDAN4A; CDAN4B; Eklf; EKLF/KLF1; Nan
Chromosome: 8
Strain of origin: C57BL/6J
Molecular note: Using CRISPR technology, sgRNA (based on ATCTTTTGGGATACGGTCCT) was designed to insert a T2A self-cleaving peptide sequence, flanked by linkers, followed by a codon improved icre sequence into the C-terminal of the Klf1 gene fused in-frame to the final leucine amino acid.