STOCK Shox2^{em1(icre)Zyliu}/J

Stock number: 039298
Product name: Shox2*V5-Cre
Strain synonyms: Shox2-3*V5-P2A-Cre
Research areas: Cell Biology Research, Neurobiology Research, Research Tools, Sensorineural Research

Description

CRISPR/Cas9 generated Shox2-3*V5-Cre knock-in mice have a 3xV5 tag and a codon-improved iCre recombinase gene, separated by a P2A self-cleaving peptide, inserted at the C-terminal of the Shox2 gene. They are useful for applications requiring the deletion of floxed sequences in spiral ganglion neurons (SGNs) of the inner ear and for tracing Shox2 expression in studies of early otic neurogenesis.

Detailed description

CRISPR/Cas9 generated Shox2-3*V5-Cre knock-in mice have a 3xV5 tag and a codon-improved iCre recombinase gene, separated by a P2A self-cleaving peptide, inserted at the C-terminal of the SHOX homeobox 2 (Shox2) gene. The insertion does not affect endogenous gene expression. The Shox2 gene, an autosomal paralog of the human SHOX gene, encodes for a homeodomain transcription factor involved in developmental patterning. Shox2 expression is specific to descendants of otic neuroblasts known as cochleovestibular ganglion (CVG) cells, with its expression higher in spiral ganglion neurons (SGNs) than in vestibular ganglion neurons (VGNs) at E13.5. Homozygotes are viable and fertile with no overt phenotype. When these mice are bred with mice containing loxP-flanked sequence, iCre-mediated recombination will result in the deletion of the floxed sequences in the otic neuroblasts.

The 3xV5 tag is detectable using an anti-V5 antibody.

Development

sgRNA (TTAGGAGGCTCCACCGACCG) was designed to insert (from 5' to 3') a 3xV5 tag, a P2A self-cleaving peptide, and a codon-improved iCre recombinase gene near the C-terminal of the SHOX homeobox 2 (Shox2) gene (based on ENSEMBL Transcript ID: Shox2-201 ENSMUST00000029422.14). sgRNA, the cas9 protein, and a donor plasmid were introduced into the cytoplasm of C57BL/6J-derived fertilized eggs with well-recognized pronuclei. Injected embryos were transferred to pseudopregnant females. Resulting Shox2-3*V5-Cre F0 mice were screened by tail PCR. The F0 mice, with potential correct targeting, were further bred to C57BL/6J mice (Stock No. 000664) for one generation for germ line transmission to develop the germ line stable colony. These F1 mice were further subject to PCR and Southern blot. Mice with no random insertion of the gene targeting vector were chosen for colony expansion. Mice were further bred to C57BL/6J mice for at least 10 generations by the donating laboratory (see SNP note below). Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

In 2024, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the males sent to The Jackson Laboratory Repository. Many of the 43 markers throughout the genome were segregating with an unknown source. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed genetic background.

Allele

Symbol: Shox2^{em1(icre)Zyliu}
Name: endonuclease-mediated mutation 1, Zhiyong Liu
MGI accession ID: MGI:7489962
Generation method: Endonuclease-mediated
Attributes: Recombinase-expressing; Epitope tag
Synonyms: Shox2*V5-Cre; Shox2-3*V5-P2A-Cre
Marker symbol: Shox2
Marker name: short stature homeobox 2
Marker synonyms: 6330543G17Rik; OG12; Og12x; Prx3; SHOT
Chromosome: 3
Strain of origin: C57BL/6J
Molecular note: Using CRISPR/Cas9 technology, 3*V5-P2A-iCre was inserted into the Shox2 locus in which three V5 tags are fused at the C terminus of the gene.