C57BL/6-Fgf8^em2Zyliu/J

Stock number: 039297
Product name: Fgf8^GFP
Strain synonyms: Fgf8-P2A-3xGFP
Research areas: Neurobiology Research, Research Tools, Sensorineural Research

Description

Fgf8^GFP knock-in mice express P2A-3xGFP directed from the endogenous Fgf8 promoter. They are useful for labeling and sorting perinatal cochlear inner hair cells (IHCs) in studies of deafness.

Detailed description

CRISPR/Cas9 generated Fgf8^GFP knock-in mice express P2A-3xGFP directed from the endogenous fibroblast growth factor 8 (Fgf8) promoter. The insertion does not affect endogenous gene expression. The Fgf8 gene encodes a growth factor that is involved in the regulation of embryonic development, cell proliferation, cell differentiation and cell migration, and is required for normal brain, eye, ear and limb development during embryogenesis. Fgf8 is highly expressed in perinatal cochlear inner hair cells (IHCs).

The 3xGFP sequence includes three distinct GFPs: Emerald-GFP (EmGFP), TagGFP2, and humanized Renilla-GFP (hrGFP). In these mice, GFP is detectable by immunostaining with EGFP antibody. Also, EGFP fluorescence can be detected at the ages when FGF8 levels are high.

Homozygotes are viable and fertile with no overt phenotype. Fgf8^GFP mice are useful for labeling and sorting perinatal cochlear inner hair cells (IHCs) in studies of deafness.

Development

sgRNA (AGCTGGGCGAGCGCCTATCG) was designed to insert a P2A self-cleaving peptide that mediates ribosomal skipping and a 3xGFP sequence (including three distinct GFPs: Emerald-GFP (EmGFP), TagGFP2, and humanized Renilla-GFP (hrGFP)) immediately upstream of the endogenous stop codon of the fibroblast growth factor 8 (Fgf8) gene (based on ENSEMBL Transcript ID: Fgf8-ENST00000320185.7). sgRNA, the cas9 mRNA, and a donor plasmid were introduced into the cytoplasm of C57BL/6J-derived fertilized eggs with well-recognized pronuclei. Injected embryos were transferred to pseudopregnant females. Resulting Fgf8^GFP F0 mice were screened by tail PCR. The F0 mice, with potential correct targeting, were further bred to C57BL/6J mice (Stock No. 000664) for one generation for germ line transmission to develop the germ line stable colony. These F1 mice were further subject to PCR and Southern blot. Mice with no random insertion of the gene targeting vector, were chosen for colony expansion. The donating laboratory reported the mice were further bred to C57BL/6J mice for at least 10 generations prior to sending males to The Jackson Laboratory Repository in 2024 (see SNP note below). Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

In 2024, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the males sent to The Jackson Laboratory Repository. One of the 5 markers that determine C57BL/6J from C57BL/6N was found to be segregating. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed C57BL/6N;C57BL/6J genetic background.

Allele

Symbol: Fgf8^em2Zyliu
Name: endonuclease-mediated mutation 2, Zhiyong Liu
MGI accession ID: MGI:7703102
Generation method: Endonuclease-mediated
Attributes: Reporter
Synonyms: Fgf8^GFP; Fgf8^P2A-3xGFP
Marker symbol: Fgf8
Marker name: fibroblast growth factor 8
Marker synonyms: Aigf; Fgf6c; Fgf-8; HBGF-8; HH6; KAL6
Chromosome: 19
Strain of origin: C57BL/6J
Molecular note: Using CRISPR/Cas9 technology, a P2A self-cleaving peptide that mediates ribosomal skipping and a 3xGFP sequence (including three distinct GFPs: Emerald-GFP (EmGFP), TagGFP2, and humanized Renilla-GFP (hrGFP)) were inserted immediately upstream of the endogenous stop codon of the fibroblast growth factor 8 (Fgf8) gene.