STOCK Fgf8^{em1(HBEGF)Zyliu}/J

Stock number: 039295
Product name: Fgf8-DTR
Strain synonyms: Fgf8-P2A-DTR-T2A-DTR
Research areas: Neurobiology Research, Research Tools, Sensorineural Research

Description

Fgf8-DTR knock-in mice express P2A-DTR-T2A-DTR directed from the endogenous Fgf8 promoter. They are useful for applications requiring diphtheria-mediated ablation of perinatal cochlear inner hair cells (IHCs) in studies of deafness.

Detailed description

CRISPR/Cas9 generated Fgf8-DTR knock-in mice express P2A-DTR-T2A-DTR directed from the endogenous fibroblast growth factor 8 (Fgf8) promoter. The insertion does not affect endogenous gene expression. The Fgf8 gene encodes a growth factor that is involved in the regulation of embryonic development, cell proliferation, cell differentiation and cell migration, and is required for normal brain, eye, ear and limb development during embryogenesis. Fgf8 is highly expressed in perinatal cochlear inner hair cells (IHCs).

Homozygotes are viable and fertile with no overt phenotype. Prior to diptheria toxin (DT) treatment, IHCs and outer hair cells (OHCs) are normal in Fgf8-DTR mice. One injection of DT at P2 specifically depletes 97.8% of IHCs by P42, with considerable IHC loss occurring in all cochlear turns. No change in OHCs is evident after DT treatment.

Development

sgRNA (AGCTGGGCGAGCGCCTATCG) was designed to insert two human diphtheria toxin receptors (DTRs), separated by 2A self-cleaving peptides, immediately upstream of the endogenous stop codon of the fibroblast growth factor 8 (Fgf8) gene (based on ENSEMBL Transcript ID: Fgf8-ENST00000320185.7). sgRNA, the cas9 mRNA, and a donor plasmid were introduced into the cytoplasm of C57BL/6J-derived fertilized eggs with well-recognized pronuclei. Injected embryos were transferred to pseudopregnant females. Resulting Fgf8-DTR F0 mice were screened by tail PCR. The F0 mice, with potential correct targeting, were further bred to C57BL/6J mice (Stock No. 000664) for one generation for germ line transmission to develop the germ line stable colony. These F1 mice were further subject to PCR and Southern blot. Mice with no random insertion of the gene targeting vector, were chosen for colony expansion. The donating laboratory reported the mice were further bred to C57BL/6J mice for at least 10 generations prior to sending males to The Jackson Laboratory Repository in 2024 (see SNP note below). Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

A 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the males sent to The Jackson Laboratory Repository. Many of the 43 markers throughout the genome were segregating with any unknown source. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed genetic background.

Allele

Symbol: Fgf8^{em1(HBEGF)Zyli}
Name: endonuclease-mediated mutation 1, Zhiyong Liu
MGI accession ID: MGI:7666613
Generation method: Endonuclease-mediated
Attributes: Inserted expressed sequence
Synonyms: Fgf8-DTR
Marker symbol: Fgf8
Marker name: fibroblast growth factor 8
Marker synonyms: Aigf; Fgf6c; Fgf-8; HBGF-8; HH6; KAL6
Chromosome: 19
Strain of origin: C57BL/6J
Molecular note: CRISPR/cas9 genome editing is used to insert two human diphtheria toxin receptors (DTRs), separated by 2A self-cleaving peptides, immediately upstream of the endogenous stop codon of the fibroblast growth factor 8 (Fgf8) gene.