STOCK Tbx2^{em1(cre/ESR1*)Zyliu}/J

Stock number: 039293
Product name: Tbx2-HA
Strain synonyms: Tbx2*3XHA-P2A-iCreER-T2A-EGFP
Research areas: Cell Biology Research, Developmental Biology Research, Research Tools, Sensorineural Research

Description

CRISPR/Cas9 generated Tbx2-HA knock-in mice have a 3XHA, a cre/ESR1* fusion gene, and a GFP sequence, separated by 2A self-cleaving peptides, inserted near the TGA stop codon in exon 7 of the Tbx2 gene. They are useful for applications requiring tamoxifen-induced deletion of floxed sequences in mature inner hair cells (IHCs) and for tracing Tbx2 expression in studies of deafness.

Detailed description

CRISPR/Cas9 generated Tbx2-HA knock-in mice have a 3XHA tag, a cre/ESR1* fusion gene, and a GFP sequence, separated by 2A self-cleaving peptides, inserted near the TGA stop codon in exon 7 of the T-box 2 (Tbx2) gene. The insertion does not affect endogenous gene expression. Tbx2 encodes a transcription factor that plays a role in maintaining the cell fate of differentiating and mature inner hair cells (IHCs) by preventing these cells from transdifferentiating into outer hair cells (OHCs). HA expression and cre/ESR1* are evident in both differentiating and mature IHCs. Restricted to the cytoplasm, Cre-ESR1* can only gain access to the nuclear compartment after exposure to tamoxifen. Homozygotes are viable and fertile with no overt phenotype. When these mice are bred with mice containing loxP-flanked sequence, tamoxifen-inducible Cre-mediated recombination will result in deletion of the floxed sequences in the IHCs of the offspring.

The donating investigator reports no Cre activity in any tissues prior to tamoxifen administration. The 3xHA tag is detectable using an anti-HA antibody and GFP expression is detectable using immunofluorescence.

Development

sgRNA (GACCCCCGACCTGCCACGCG) was designed to insert (from 5' to 3') a 3Xhemagluttin tag (HA), a P2A self-cleaving peptide, a cre/ESR1* fusion gene (a Cre recombinase fused to a mutated estrogen receptor binding domain), a T2A peptide, and an EGFP sequence near the TGA stop codon in exon 7 of the T-box 2 (Tbx2) gene. sgRNA, the cas9 protein, and a donor plasmid were introduced into the cytoplasm of C57BL/6J-derived fertilized eggs with well-recognized pronuclei. Injected embryos were transferred to pseudopregnant females. Resulting Tbx2-HA F0 mice were screened by tail PCR. The F0 mice, with potential correct targeting, were further bred to C57BL/6J mice (Stock No. 000664) for one generation for germ line transmission to develop the germ line stable colony. These F1 mice were further subject to PCR and Southern blot. Mice with no random insertion of the gene targeting vector were chosen for colony expansion. Mice were further bred to C57BL/6J mice for at least 10 generations by the donating laboratory (see SNP note below). Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

A 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the males sent to The Jackson Laboratory Repository. Many of the 43 markers throughout the genome were segregating with any unknown source. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed genetic background.

Allele

Symbol: Tbx2^{em1(cre/ESR1*)Zyliu}
Name: endonuclease-mediated mutation 1, Zhiyong Liu
MGI accession ID: MGI:7495797
Generation method: Endonuclease-mediated
Attributes: Recombinase-expressing; Reporter; Inducible; Epitope tag
Synonyms: Tbx2*3XHA-P2A-iCreER-T2A-EGFP; Tbx2-HA
Marker symbol: Tbx2
Marker name: T-box 2
Marker synonyms: VETD
Chromosome: 11
Strain of origin: C57BL/6J
Molecular note: CRISPR/cas9 genome editing is used to insert a 3Xhemagluttin tag (HA), a P2A self-cleaving peptide sequence, an cre/ERT2, a T2A site, followed by an EGFP reporter close to the TGA stop codon in exon 7.