C57BL/6J-Trac^{em1(Tcrb,Tcra)Strom} Msln^em1Strom/J

Stock number: 039279
Product name: 1045 Msln^-
Research areas: Research Tools

Description

1045 Msln^- mice express high affinity mesothelin (Msln)-specific T cell receptor (TCR) from the mouse T cell receptor alpha constant (Trac) locus in combination with a knock-out of the endogenous Msln gene. This strain demonstrates T cell receptor exchange (TRex), an improved alternative to traditional transgenic methodologies that enables robust and efficient TCR expression from the targeted environment of the endogenous Trac locus. Expression from Trac confers resistance to T cell functional loss and increases TCR avidity while preserving physiologic T cell development. This strain is useful in studies of T cell-directed cancer therapies.

Detailed description

Mesothelin (Msln) is a self-antigen overexpressed in many malignancies and a promising target for T cell-directed cancer therapies. 1045 Msln^- mice express Msln-specific T cell receptor (TCR) from the mouse T cell receptor alpha constant (Trac) locus in combination with a knock-out of the endogenous Msln gene to circumvent T cell tolerance. The Vα4 and Vβ9 TCR demonstrates high affinity for the Msln_406-414:H-2D^b epitope. Trac targeting confers resistance to T cell functional loss and increases TCR avidity while preserving physiologic T cell development.

This strain demonstrates T cell receptor exchange (TRex), an improved alternative to traditional transgenic methodologies that enables robust and efficient TCR expression from the environment of the endogenous Trac locus. Expression from Trac confers resistance to T cell functional loss and increases TCR avidity while preserving physiologic T cell development.

A similar TCR model demonstrating a lower affinity for the the Msln_406-414:H-2D^b epitope is also available (see Stock No. 039444). TCRs in both the higher (Stock No. 039279) and lower (Stock No. 039444) affinity strains utilize Vα4 and Vβ9 and differ only in the CDR3 sequences within the chains, which largely contribute to TCR specificity.

Development

CRISPR-READI (CRISPR RNP Electroporation and AAV Donor Infection) methodologies were applied to introduce an in-frame, high affinity (clone 1045), codon optimized, Msln_406-414:H-2D^b-specific Vα4/Vβ9 T cell receptor (TCR) to exon 1 of the mouse Trac gene and simultaneously delete 23 bp from the 5’ end of exon 4 of the endogenous Msln gene to create a knock-out allele.

TCR clone 1045 TCRβ variable (V), TCRβ constant (C) and TCRα V, linked by a self-cleaving P2A element and flanked by homology arms (HA) encoding endogenous Trac genomic sequences were introduced to C57BL/6J embryos through adenoviral vector (AAV) rAAV6. SgRNAs recognizing exon 1 of Trac (UUCUGGGUUCUGGAUGUCUG; −54220521; ENSMUST00000198398) and exon 4 of Msln (GGCCAAGAAAGAGGCCUGUG; +25753054; ENSMUST00000238120) were used in conjunction with Cas9 protein as ribonucleoprotein (RNP) complexes in the electroporation step. Resultant mice were maintained on a C57BL/6J genetic background by the donating laboratory. Upon arrival, sperm was cryopreserved. To establish a live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).

A similar TCR model demonstrating a lower affinity for the Msln_406-414:H-2D^b epitope is also available (see Stock No. 039444). TCRs in both the higher (Stock No. 039279) and lower (Stock No. 039444) affinity strains utilize Vα4 and Vβ9 and differ only in the CDR3 sequences within the chains, which largely contribute to TCR specificity.

Note: The male mice sent to The Jackson Laboratory were found to be homozygous for the Thy1^a (thymus cell antigen 1, theta; a variant) allele. Mice cryorecovered from their frozen sperm using C57BL/6J oocytes (Thy1^b) or acquired from an established live colony may carry the Thy1^a and/or Thy1^b alleles. August, 2024

Allele

Symbol: Trac^{em1(Tcrb,Tcra)Strom}
Name: endonuclease-mediated mutation 1, Ingunn Stromnes
MGI accession ID: MGI:7645418
Generation method: Endonuclease-mediated
Attributes: Null/Knockout; Inserted expressed sequence
Synonyms: 1045 TRex
Marker symbol: Trac
Marker name: T cell receptor alpha constant
Marker synonyms: Gm16914; IMD7; TCRA; Tcra-C; TRA@; TRCA
Chromosome: 14
Strain of origin: C57BL/6J
Molecular note: CRISPR technology was used to introduce an in-frame, high affinity (clone 1045), codon-optimized, Msln406-414:H-2Db-specific Valpha4/Vbeta9 T cell receptor (TCR) clone 1045 consisting of TCRb variable (V), TCRb constant (C) and TCRa V, linked by a self-cleaving P2A element to exon 1 of the mouse Trac gene and simultaneously delete 23 bp from the 5’ end of exon 4 of the endogenous Msln gene to create a knock-out allele.

Allele

Symbol: Msln^em1Strom
Name: endonuclease-mediated mutation 1, Ingunn Stromnes
MGI accession ID: MGI:7645420
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Synonyms: Msln^-
Marker symbol: Msln
Marker name: mesothelin
Marker synonyms: C-ERC; megakaryocyte potentiating factor; MPF; SMRP
Chromosome: 17
Strain of origin: C57BL/6J
Molecular note: Using CRISPR/Cas9 technology, SgRNAs recognizing exon 4 of Msln (GGCCAAGAAAGAGGCCUGUG; +25753054; ENSMUST00000238120) were targetted result in Msln indel causing disruption.