B6(129S4)-Igs79^em1Aven Igs80^em1Aven/J

Stock number: 039222
Product name: Mdm2^ec
Research areas: Cancer Research, Cell Biology Research, Research Tools

Description

Mdm2^ec mice carry a mutation that results in loxP sites flanking a 1.3 Mbp on chromosome 10 (chr10:116711442-18002454) containing the Mdm2 oncogene and a dozen other genes. These mice may be useful when studying extrachromosomal circular DNA (ecDNA) biology and ecDNA roles in tumor formation and progression.

Detailed description

Mdm2^ec mice have loxP sites flanking a 1.3 Mbp on chromosome 10 (chr10:116711442-18002454) containing the transformed mouse 3T3 cell double minute 2 (Mdm2) oncogene and a dozen other genes. Exposure to Cre recombinase will result in the excision and subsequent circularization of the region between the loxP sites as a circular DNA molecule that recapitulates extrachromosomal circular DNAs (ecDNAs) detected in human cancer cells. ecDNAs, also known as "double minutes", represent a common mechanism for focal oncogene amplification. Mdm2 encodes an oncogene that is amongst the most commonly amplified on ecDNA in human cancers.

Mice that are homozygous for this floxed allele are viable and fertile. When bred to mice that express tissue-specific Cre recombinase or injected with Cre recombinase expression vectors, circularization and scar on the linear chromosome can be detected. Accumulation of ecDNA will occur if they provide a selective advantage for cells harboring them. These mice may be useful when studying ecDNA biology and ecDNA roles in tumor formation and progression.

Of note, Myc^ec mice (Stock No. 039221) are a similar strain with loxP sites flanking a 1.7 Mbp genomic region on chromosome 15, containing the Myc oncogene.

Development

Guide RNAs (TCTTACAGCATACTACGGTC and TTCTGCGATTCGTTATGCGT) were designed to insert loxP sites flanking a 1.3 Mbp genomic region on chromosome 10 (chr10:116711442-118002454), spanning from the myelin regulatory factor-like (Myrfl) gene to the RAS related protein 1b (Rap1b) gene, including the transformed mouse 3T3 cell double minute 2 (Mdm2) gene. gRNAs, single strand DNA donor, and Cas9 protein were electroporated into mouse early pronuclear zygotes from C57BL/6J mice. Correctly targeted embryos were transferred to pseudopregnant females and resulting Mdm2^ec pups were identified by PCR and Sanger sequencing. A single founder female was selected and breed to a LSL-K-ras G12D male (Stock No. 008179). Resulting progeny were bred together and the LSL-K-ras G12D allele was removed from the colony. Mdm2^ec mice were further bred together for at least 5 generations by the donating laboratory. It is unknown if any off-target CRISPR changes are present. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).

Allele

Symbol: Igs79^em1Aven
Name: endonuclease-mediated mutation 1, Andrea Ventura
MGI accession ID: MGI:7620007
Generation method: Endonuclease-mediated
Attributes: Not Applicable
Marker symbol: Igs79
Marker name: intergenic site 79
Chromosome: 10
Strain of origin: C57BL/6J
Molecular note: Guide RNAs (TCTTACAGCATACTACGGTC and TTCTGCGATTCGTTATGCGT) were designed to insert loxP sites flanking a 1.3 Mbp genomic region on chromosome 10 (chr10:116711442-18002454), spanning from the Myrfl gene to the Rap1b gene, including the Mdm2 gene. This allele is a proximal loxP insertion site that pairs with Igs80.

Allele

Symbol: Igs80^em1Aven
Name: endonuclease-mediated mutation 1, Andrea Ventura
MGI accession ID: MGI:7620008
Generation method: Endonuclease-mediated
Attributes: Not Applicable
Marker symbol: Igs80
Marker name: intergenic site 80
Chromosome: 10
Strain of origin: C57BL/6J
Molecular note: Guide RNAs (TCTTACAGCATACTACGGTC and TTCTGCGATTCGTTATGCGT) were designed to insert loxP sites flanking a 1.3 Mbp genomic region on chromosome 10 (chr10:116711442-18002454), spanning from the Myrfl gene to the Rap1b gene, including the Mdm2 gene. This allele is a distal loxP insertion site that pairs with Igs79.