FVB/NJ-Slc26a5^em2Kazh/J

Stock number: 039136
Product name: S396D-prestin
Strain synonyms: Slc26a5^S396D
Research areas: Neurobiology Research, Research Tools, Sensorineural Research

Description

S396D-prestin knock-in (KI) mice carry a CRISPR/Cas9-generated missense point-mutation in the Slc26a5 gene, resulting in a serine to aspartic acid substitution (S396D) in the anion binding site. These mice may be useful for studying bilateral sensorineural hearing loss.

Note that the donating laboratory has made multiple Slc26a5 knock-in mouse lines available: R130S-prestin KI (Stock No. 039135), S396D-prestin KI (Stock No. 039136), R130S/S396D-prestin KI (Stock No. 039137) and P119S-prestin-KI (Stock No. 040843).

Detailed description

Solute carrier family 26 member 5 (SLC26A5), also referred to as Prestin, is a voltage-dependent motor protein expressed in the outer hair cells (OHC) of the cochlea. Prestin induces voltage-driven changes in OHC length. This cochlear OHC contraction and expansion, called electromotility, is essential for normal hearing in mammals. The S396D-prestin knock-in (KI) mouse line expresses a CRISPR/Cas9-generated missense point mutation resulting in a serine to aspartic acid amino acid substitution (S396D) in the anion translocation pathway. This substitution mimics the chloride bound state of the protein and abrogates the reportedly weak anion transport activity.

Homozygous S396D-prestin KI mice are viable and fertile. The hearing phenotype of homozygous mice is similar to wildtype. These KI mice may be useful for studying regulation of mammalian cochlear amplification as well as auditory disorders such as bilateral sensorineural hearing loss.

Note that the donating laboratory has made multiple Slc26a5 knock-in mouse lines available: R130S-prestin KI (Stock No. 039135), S396D-prestin KI (Stock No. 039136), R130S/S396D-prestin KI (Stock No. 039137) and P119S-prestin-KI (Stock No. 040843).

Development

The S396D-prestin knock-in (KI) allele was generated using CRISPR/Cas9 endonuclease-mediated homology-directed repair (HDR) genome editing. Guide RNA [gRNA-37R (CTGAACAAGGCTTCGAGACA)] was used to introduce a point mutation in exon 11 of the solute carrier family 26, member 5 (Slc26a5) gene, resulting in a serine to aspartic acid amino acid substitution at residue 396 (S396D). Canonical Slc26a5 transcript (NM_030727.5) was used as reference for the exon number and the guide sequences. The sgRNAs, ssDNA, and cas9 nuclease mRNA were introduced into the cytoplasm of zygotes derived from FVB/NJ (Stock No. 001800) mice with well recognized pronuclei. Correctly targeted pups were identified by PCR and sequencing. The resulting S396D-prestin KI mice were backcrossed to FVB/NJ background for at least 3 generations by the donating laboratory. The donating investigator sequenced the top 5 loci for each guide and confirmed that there were no off-target edits in these loci. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize FVB/NJ oocytes (Stock No. 001800).

Allele

Symbol: Slc26a5^em2Kazh
Name: endonuclease-mediated mutation 2, Kazuaki Homma
MGI accession ID: MGI:7543153
Generation method: Endonuclease-mediated
Attributes: Constitutively active
Synonyms: S396D-prestin
Marker symbol: Slc26a5
Marker name: solute carrier family 26, member 5
Marker synonyms: DFNB61; Pres; prestin
Chromosome: 5
Strain of origin: FVB/NJ
Molecular note: Serine codon 396 (TCC) in exon 11 was changed to aspartic acid (GAC) (p.S396D) using an sgRNA and an ssODN template with CRISPR/Cas9 technology. The mutation renders the encoded peptide constitutively active, mimicking the chloride-bound state.