FVB/NJ-Slc26a5^em1Kazh/J

Stock number: 039135
Product name: R130S-prestin
Strain synonyms: Slc26a5^R130S
Research areas: Neurobiology Research, Research Tools, Sensorineural Research

Description

R130S-prestin knock-in (KI) mice carry a CRISPR/Cas9-generated clinical mutation (R130S) in the Slc26a5 gene. These mice may be useful for studying bilateral sensorineural hearing loss.

Note that the donating laboratory has made multiple Slc26a5 knock-in mouse lines available: R130S-prestin KI (Stock No. 039135), S396D-prestin KI (Stock No. 039136), R130S/S396D-prestin KI (Stock No. 039137) and P119S-prestin-KI (Stock No. 040843).

Detailed description

Solute carrier family 26 member 5 (SLC26A5), also referred to as Prestin, is a voltage-dependent motor protein expressed in the outer hair cells (OHC) of the cochlea. Prestin induces voltage-driven changes in OHC length. This OHC contraction and expansion, called electromotility, is essential for normal hearing in mammals. This R130S-prestin knock-in (KI) mouse model expresses a CRISPR/Cas9-generated point mutation resulting in an arginine to serine amino acid substitution (R130S). This mutation is the equivalent of the human mutation (p.R130S, c.390A>C) associated with bilateral sensorineural hearing loss.

Heterozygous and homozygous R130S-prestin KI mice are viable and fertile; however, homozygous mice demonstrate frequency-dependent progressive congenital hearing loss. Progressive OHC loss starting from the basal region of cochlea is also noted in homozygous mice becoming evident at 3-4 weeks of age. R130S prestin variant is hypofunctional with slowed motor kinetics. This KI mouse model may be useful for studying regulation of mammalian cochlear amplification as well as auditory disorders such as bilateral sensorineural hearing loss.

Note that the donating laboratory has made multiple Slc26a5 knock-in mouse lines available: R130S-prestin KI (Stock No. 039135), S396D-prestin KI (Stock No. 039136), R130S/S396D-prestin KI (Stock No. 039137) and P119S-prestin-KI (Stock No. 040843).

Development

The R130S-prestin knock-in (KI) allele was generated using CRISPR/Cas9 endonuclease-mediated homology-directed repair (HDR) genome editing. Guide RNAs [sgRNA-G11 (ACCTATAGATATGTGTCTTGAGG) and sgRNA-G13 (ACCTCAAGACACATATCTATAGG)] were used to introduce a point mutation (c.390A>T) in exon 5 of the solute carrier family 26, member 5 (Slc26a5) gene, resulting in an arginine to serine amino acid substitution at residue 130 (R130S). An additional silent mutation (c.387A>G, p.S129S) was introduced to create a diagnostic XhoI restriction site, replacing the wildtype Hpy188III site. Canonical Slc26a5 transcript (NM_030727.5) was used as reference for the exon number and the guide sequences. The sgRNAs, ssDNA, and cas9 nuclease mRNA were introduced into the cytoplasm of zygotes derived from FVB/NJ (Stock No. 001800) mice with well recognized pronuclei. Correctly targeted pups were identified by PCR and sequencing. The resulting R130S-prestin KI mice were backcrossed to FVB/NJ background for at least 3 generations by the donating laboratory. The donating investigator sequenced the top 5 loci for each guide and confirmed that there were no off-target edits in these loci. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize FVB/NJ oocytes (Stock No. 001800).

Allele

Symbol: Slc26a5^em1Kazh
Name: endonuclease-mediated mutation 1, Kazuaki Homma
MGI accession ID: MGI:7541599
Generation method: Endonuclease-mediated
Attributes: Hypomorph; Humanized sequence
Synonyms: R130S-prestin
Marker symbol: Slc26a5
Marker name: solute carrier family 26, member 5
Marker synonyms: DFNB61; Pres; prestin
Chromosome: 5
Strain of origin: FVB/NJ
Molecular note: Arginine codon 130 (AGA) in exon 5 was changed to serine (AGT) (c.390A>T, p.R130S) using an sgRNA and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation (c.390A>C) associated with bilateral sensorineural hearing loss. An additional silent mutation (c.387A>G, p.S129S) was introduced to create a diagnostic XhoI restriction site, replacing the wildtype Hpy188III site.