C57BL/6-Npl^em1Avps/J

Stock number: 039113
Product name: Npl^R63C
Research areas: Cardiovascular Research, Metabolism Research, Mouse/Human Gene Homologs

Description

Npl^R63C mice carry a CRISPR/cas9 generated arginine to cysteine missense mutation at amino acid 63 (R63C) in exon 4 of the Npl gene, homologous to a mutation found in two related patients who presented with cardiomyopathy, mild skeletal myopathy, and sensorineural hearing loss symptoms. This mouse line may be useful when studying the role of NPL and sialic acid metabolism on muscle function and regeneration.

Detailed description

Npl^R63C mice carry a CRISPR/cas9 generated arginine to cysteine missense mutation at amino acid 63 (R63C) in exon 4 of the N-acetylneuraminate pyruvate lyase (Npl) gene, homologous to a mutation found in two related patients who presented with cardiomyopathy, mild skeletal myopathy, and sensorineural hearing loss symptoms. These patients also secreted high levels of free sialic acid in their urine. Npl encodes an enzyme that regulates cellular concentrations of sialic acid by mediating the reversible conversion of sialic acid into N-acetylmannosamine and pyruvate. Sialic acids are important components of glycan chains in glycoproteins and glycolipids and are involved in cellular communication, migration, adhesion, tumor cell metastases, and infection. Mutations in Npl were first discovered to cause skeletal myopathy and cardiac edema in humans.

The R63C mutation in these mice causes almost complete loss of NPL enzyme activity. NPL deficiency causes a drastic increase in free sialic acid levels, reduction of skeletal muscle force and endurance, slower healing, and smaller size of newly formed myofibers after cardiotoxin-induced muscle injury, increased glycolysis, and partially impaired mitochondrial function.

mRNA levels in the kidneys of Npl^R63C/R63C homozygous mice are similar to that found in WT mice, although NPL enzyme activity is reduced to the background level in tissues of the mice. Homozygous mice are viable and fertile.

Of note, in Npl^del116 mice (Stock No. 039114), a 116 bp deletion in Npl also results in complete loss of NPL enzyme activity. In contrast to the Npl^R63C mice, no mRNA transcript is detectable in Npl^del116 mice. Also, Npl^R63C mice have a slightly milder phenotype than Npl^del116 mice and lower levels of sialic acid in the urine.

Development

A single-guide RNA (TGAACGTCGCCAGGTCGCGG) was designed to target the N-acetylneuraminate pyruvate lyase (Npl) gene. Single-stranded oligodeoxynucleotide (ssODN) was designed to encode a c.270C>T mutation resulting in an arginine to cysteine missense mutation at amino acid 63 (R63C), homologous to a mutation found in a patient who presented with cardiomyopathy, mild skeletal myopathy, and sensorineural hearing loss symptoms. This substitution also disrupts the Hpy99I restriction site. sgRNA, ssODN, and the Cas9 mRNA were introduced into the nucleus of C57BL/6NHsd-derived zygotes. Correctly targeted embryos were transferred to pseudopregnant females. Npl^R63C pups were identified by Sanger sequencing and PCR and founder mice were further bred to C57BL/6NCrl for 14 generation by the donating laboratory (see SNP note below) to develop the colony and remove any off-target CRISPR changes. Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6NJ oocytes (Stock No. 005304).

In 2024, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the rederived living colony at The Jackson Laboratory Repository. One of the 5 markers that determine C57BL/6J from C57BL/6N was found to be segregating. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed C57BL/6N;C57BL/6J genetic background.

Allele

Symbol: Npl^em1Avps
Name: endonuclease-mediated mutation 1, Alexey Pshezhetsky
MGI accession ID: MGI:7567785
Generation method: Endonuclease-mediated
Attributes: Humanized sequence
Synonyms: Npl^R63C
Marker symbol: Npl
Marker name: N-acetylneuraminate pyruvate lyase
Marker synonyms: 0610033B02Rik; C112; C1orf13; NAL; NPL1
Chromosome: 1
Strain of origin: C57BL/6NHsd
Molecular note: Arginine codon 63 (CGT) in exon 4 was changed to cysteine (TGT) (c.187C>T p.R63C) using an sgRNA (targeting TGAACGTCGCCAGGTCGCGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with sialic acid metabolism disorder leading to cardiomyopathy, mild skeletal myopathy, and sensorineural hearing loss. Transcripts are expressed from this allele but not proteins.