B10;CBACa-Hoxa2^em1Krum/J

Stock number: 039079
Product name: a2KO
Strain synonyms: Hoxa2-ATG-XhoI
Research areas: Developmental Biology Research, Internal/Organ Research

Description

a2 knock-out (KO) mice harbor a CRISPR-generated mutation in the start codon of the homeobox A2 (Hoxa2) gene, resulting in a null allele. These mice may be useful for studying the regulation of neural crest cell migration and early craniofacial development.

Detailed description

This a2 knock-out (KO) strain carries a CRISPR-generated mutation in the start codon of the homeobox A2 (Hoxa2) gene, resulting in a null allele. Hoxa2 codes for a transcription factor that is expressed in several developing tissues, including the neural tube, neural crest-derived mesenchyme of the branchial area and pharyngeal arches, and is necessary for craniofacial development. HOXA2 has also been found to be essential for proper segmentation and patterning of the hindbrain.

Heterozygous mice are viable and fertile with no over phenotype. Homozygous mice are perinatal lethal and display a "cauliflower" ear phenotype. These homozygous mice also demonstrate a duplication of PA1-derived middle ear elements at embryonic age 18.5 (E18.5), but do not show a cleft palate defect. These mice may be useful for studying the embryonic development of craniofacial morphology.

Development

The a2 knock-out (KO) allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. Guide RNAs [CACCGCCGAGGGGGCTCCAAGGAGA and AAACTCTCCTTGGAGCCCCCTCGGC] were used to target the homeobox A2 (Hoxa2) gene on chromosome 6. These gRNAs were developed to mutate a 7 bp region (5'-AGGCCATG-3'), including part of the start codon of Hoxa2, by deleting 2 bp and converting it into an XhoI site (5'-CTCGAG-3'). The guide RNAs, donor sequence (CTTGCCCCCCCAAAGCCCCTCCAAAAGAGGGAACTTTTCCTCCGAGGGGGCTCCAAGGAGACTCGAGAATTACGAATTTGAGCGAGAGATTGGTTTTATCAATAGCCAGCCGTCGCTCGCTGAGTGC) and Cas9 nuclease were introduced into (CBA/CaJ x C57BL/10) F1 zygotes and transferred to pseudopregnant females. Correctly targeted pups were identified by PCR and sequencing. The resulting heterozygous a2 KO mice were maintained on a mixed B10;CBA background by the donating laboratory. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize CBA/CaJ oocytes (Stock No. 000654).

Allele

Symbol: Hoxa2^em1Krum
Name: endonuclease-mediated mutation 1, Robb Krumlauf
MGI accession ID: MGI:7579143
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Synonyms: a2KO
Marker symbol: Hoxa2
Marker name: homeobox A2
Marker synonyms: Hox-1.11; HOX1K; Hoxa11; Hoxa-2; Hoxa2l; MCOHI; RATHOX111A
Chromosome: 6
Strain of origin: (CBA/CaJ × C57BL/10)F1
Molecular note: Using CRISPR/Cas9 endonuclease-mediated genome editing, to mutate a 7 bp region (5'-AGGCCATG-3'), including part of the start codon of Hoxa2, by deleting 2 bp of the start codon and converting it into an XhoI site (5'-CTCGAG-3').