NOD.Cg-H2-K1^d-em1Dvs H2-Ab1^g7-em1Dvs H2-D1^b-em5Dvs Tg(HLA-DQA1,HLA-DQB1)1Dv Tg(CD2-TcraA1.9,Cd4-TcrbA1.9)1Dvs Tg(INS*)172Dvs/DvsJ

Stock number: 039056
Product name: cMHCKO.DQ8.hINS-A1.9.1 , NOD-cMHCI/II^-/-.DQ8-A1.9.hINS , DQ8-A1.9.hINS
Research areas: Diabetes and Obesity Research, Immunology, Inflammation and Autoimmunity Research, Research Tools

Description

NOD-cMHCI/II^-/-.DQ8-A1.9.hINS (DQ8-A1.9.hINS) mice carry knock-out alleles for the classical MHC class I genes, H2-D1 and H2-K1, and the class II gene, H2-Ab1 (I-A) in addition to transgenes encoding human HLA-DQ8 (HLA-DQA*0301, DQB*0302), the A1.9 TCR recognizing human C-peptide_42-50 in a DQ8-restricted manner, and Tg(INS*)172Dvs, a human proinsulin allele with the class I ACAGGGGTGTGGGG variable number of tandem repeats sequence associated with T1D development. Human insulin and C-peptide are detectable in the pancreas. This strain is one of a series of mouse models expressing various combinations of HLA I and II alleles plus or minus transgenes encoding disease-relevant human TCRs (hTCRs) isolated from type I diabetes (T1D) patients (Racine, 2023 - PMID: 37877672).

Detailed description

Development of Type 1 diabetes (T1D) is associated with specific major histocompatibility class I and class II variants in both humans and mouse. NOD-cMHCI/II^-/-.DQ8-A1.9.hINS (DQ8-A1.9.hINS) mice are deficient in classical MHC class I (cMHCI) expression (H2-K1^d-em1Dvs, H2-D1^b-em5Dvs), lack classical MHC class II (cMHCII) molecules (H2-Ab1^g7-em1Dvs), and express transgenes encoding human HLA-DQ8 (HLA-DQA*0301, DQB*0302), the A1.9 TCR recognizing human C-peptide_42-50 in a DQ8-restricted manner, and Tg(INS*)172Dvs, a human proinsulin allele with the class I ACAGGGGTGTGGGG variable number of tandem repeats sequence associated with T1D development. The A1.9 hTCR cross-reacts only weakly with murine proinsulin. Human insulin and C-peptide are detectable in the pancreas of this founder line (line172). By 10-15 weeks of age, the DQ8-A1.9.hINS mice already have increased insulitis compared with DQ8-A1.9 littermates lacking the Tg(INS*)172Dvs transgene.

Development

NSG.H2Ab⁰.DQ8.hINS mice (NOD.Cg-Prkdc^scidH2-Ab1^b-tm1DoiIl2rg^tm1Wjl Tg(HLA-DQA1,HLA-DQB1)1Dv Tg(INS*)172Dvs/SzJ; Stock No. 026936) were crossed to the NOD-cMHCI/II^-/-.DQ8 strain (NOD.Cg-H2-K1^d-em1Dvs H2-Ab1^g7-em1Dvs H2-D1^b-em5Dvs Tg(HLA-DQA1,HLA-DQB1)1Dv/DvsJ ; Stock No. 039053). Offspring hemizygous for Tg(INS*)172Dvs were continually backcrossed to NOD-cMHCI/II^-/-.DQ8 mice to remove the Prkdc^scid, H2Ab⁰, and Il2rg^tm1Wjl mutations. Resulting NOD-cMHCI/II^-/-.DQ8.hINS mice were crossed to the DQ8-A1.9 strain (details below) for two generations to refix A1.9 TCR transgenes to homozygosity and create this NOD-cMHCI/II^-/-.DQ8-A1.9.hINS (DQ8-A1.9.hINS) strain (Stock No. 039056).

To create the DQ8-A1.9 strain, human A1.9 TCR sequences recognizing human C-peptide_42-50 in a DQ8-restricted manner were fused to murine constant regions to create chimeric TCR genes. TCRα sequences were inserted into vector pCD2, which drives expression from a human CD2 promoter. TCRβ sequences were inserted into p428, which drives expression from a murine CD4 promoter. Transgenic fragments were isolated and injected into NOD-cMHCI/II^-/- (Stock No. 031858) zygotes. Founders were crossed with NOD-cMHCI/II^-/-.DQ8 mice (Stock No. 039053) for 2 generations to create the DQ8-A1.9 strain.

The donating laboratory maintained the DQ8-A1.9.hINS strain through sister-brother matings of mice hemizygous for the Tg(INS*)172Dvs allele (hINS^hemi, homozygous for the other 5 alleles) with animals lacking the Tg(INS*)172Dvs allele (hINS^-, homozygous for the other 5 alleles).

The integration site and the copy number of the HLA and TCR transgenes are unknown (December, 2023).

Allele

Symbol: Tg(HLA-DQA1,HLA-DQB1)1Dv
Name: transgene insertion 1, Chella David
MGI accession ID: MGI:3586633
Generation method: Transgenic
Attributes: Inserted expressed sequence; Humanized sequence
Synonyms: Abeta⁰.DQ8; DQ8; HLA-DQ8; HLA-DQ8 Tg; HLA-DQA1*0301/DQB1*0302; Tg(HLA-DQA1*301,HLA-DQB1*302)1Dv
Marker symbol: Tg(HLA-DQA1,HLA-DQB1)1Dv
Marker name: transgene insertion 1, Chella David
Marker synonyms: Abeta⁰.DQ8; DQ8; HLA-DQ8; HLA-DQ8 Tg; Tg(HLA-DQA1*301,HLA-DQB1*302)1Dv
Chromosome: UN
Strain of origin: (CBA/J x B10.M-H2^f)F2
Expressed genes: HLA-DQA1,major histocompatibility complex, class II, DQ alpha 1,human; HLA-DQB1,major histocompatibility complex, class II, DQ beta 1,human
Molecular note: A 30-kb human genomic DNA fragment containing the entire HLA-DQA1*0301 gene and a promoter-truncated HLA-DQB1*0302 gene from cosmid H11A and a 38-kb DNA fragment containing the entire HLA-DQB1*0302 gene from cosmid X10A were coinjected.
General note: Flow cytometric analysis of peripheral blood leukocytes (PBL) using a monoclonal antibody to HLA-DQ demonstrated that transgenic mice express the transgenes. 25-40% of the PBLs of mixed-background transgenic mice homozygous for the targeted MHC class II mutation H2-Ab1^tm1Dim express the transgenes. Lymph nodes of such mice contain three-fold the levels of CD4⁺ CD44⁺ T-cells as do those of nontransgenic MHC class II-deficient mice, levels similar to those of class II-sufficient mice. Immunization of transgenic H2-Ab1^tm1Dim homozygous mice with bovine collagen II results in a strong IgG antibody response to the immunogen, and 66% of these mice develop severe, persistent arthritis. (J:88296)

Allele

Symbol: H2-Ab1^g7-em1Dvs
Name: endonuclease-mediated mutation 1, Jackson
MGI accession ID: MGI:6101479
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Synonyms: H2-Ab1^em1Dvs
Marker symbol: H2-Ab1
Marker name: histocompatibility 2, class II antigen A, beta 1
Marker synonyms: A beta; Abeta; Bb; CELIAC1; DQB2; H-2Ab; H2-Ab; HLA-DQB; HLA-DQB1; HLA-DXB; I-A^b; Ia2; Ia-2; IAb; I-Abeta; IDDM1; Rmcs1; RT1.B
Chromosome: 17
Strain of origin: NOD/ShiLtDvs-H2-K1^d-em1Dvs H2-D1^b-em5Dvs/Dvs
Molecular note: Cas9 RNA and four guide sequences targeting Exon 2 (CCAACGGGACGCAGCGCATA, CGAAGCGCAGGTACTCCTCC, CGACGTGGGCGAGTACCGCG, ACACAACTACGAGGAGACGG) were injected into NOD/ShiLtDvs-H2-K1^em1Dvs H2-D1^em5Dvs/Dvs embryos yielding this 181bp deletion (ATACGGCTCGTGACCAGATACATCTACAACCGGGAGGAGTACCTGCGCTTCGACAGCGACGTGGGCGAGTACCGCGCGGT GACCGAGCTGGGGCGGCACTCAGCCGAGTACTACAATAAGCAGTACCTGGAGCGAACGCGGGCCGAGCTGGACACGGCGT GCAGACACAACTACGAGGAGA) within Exon 2 of H2-Ab1. Flow cytometry showed a paucity of CD8+ and CD4+ T-cells in the blood, and flow cytometry showing loss of H2-D, H2-K, and I-A on blood B-cells.

Allele

Symbol: H2-K1^d-em1Dvs
Name: endonuclease-mediated mutation 1, David V Serreze
MGI accession ID: MGI:6119459
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Synonyms: H2-K1^em1Dvs
Marker symbol: H2-K1
Marker name: histocompatibility 2, K1, K region
Marker synonyms: AS; B-4901; CDA12; D6S204; H-2K; HLA-5.4; HLA-6.2; HLAA; HLAB; HLAC; HLA-CDA12; HLAF; HLAHP; HLA-JY3; HLC-C; MHC; MHC-G; PSORS1; QA1; RT1.A2(N); RT1.Cg; RT1A-2; RT1-A2n; RT1-C/E1; RT1-C/E2; RT1-CE12; RT1-Uav1; RT1-Uc; RT1-Ulv1
Chromosome: 17
Strain of origin: NOD/ShiLtDvs
Molecular note: This single nucleotide (G) deletion within exon 2 was shown by flow cytometry to cause a null allele. it was generated by injection of Cas9 and guide sequences GTACATCTCTGTCGGCTATG targeting H2-D1^b and ATAATCCGAGATTTGAGCCG targeting H2-K1^d into NOD/ShiLtDvs embryos, which resulted in this point deletion and the intragenic deletions of H2-D1^em5Dvs.

Allele

Symbol: H2-D1^b-em5Dvs
Name: endonuclease-mediated mutation 5, David V Serreze
MGI accession ID: MGI:6119467
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: H2-D1
Marker name: histocompatibility 2, D region locus 1
Marker synonyms: AS; B-4901; CDA12; D6S204; H-2D; HLA-5.4; HLA-6.2; HLAA; HLAB; HLAC; HLA-CDA12; HLAF; HLAHP; HLA-JY3; HLC-C; MHC; MHC-G; PSORS1; QA1; RT1.A2(N); RT1.Cg; RT1A-2; RT1-A2n; RT1-C/E1; RT1-C/E2; RT1-CE12; RT1-Uav1; RT1-Uc; RT1-Ulv1
Chromosome: 17
Strain of origin: NOD/ShiLtDvs
Molecular note: Cas9 and guide sequences GTACATCTCTGTCGGCTATG targeting H2-D1^b and ATAATCCGAGATTTGAGCCG targeting H2-K1^d were injected into NOD/ShiLtDvs embryos resulting in two deletions in exon 2, one 11 bp and one 3 bp, in addition to the single nucleotide deletion that is H2-K1^em1Dvs.

Allele

Symbol: Tg(INS*)172Dvs
Name: transgene insertion 172, David V Serreze
MGI accession ID: MGI:5903249
Generation method: Transgenic
Attributes: Inserted expressed sequence; Humanized sequence
Synonyms: INS*VNTR
Marker symbol: Tg(INS*)172Dvs
Marker name: transgene insertion 172, David V Serreze
Chromosome: UN
Strain of origin: NOD.Cg-Prkdc^scid Il2rg^tm1Wjl/SzJ
Expressed genes: INS,insulin,human
Site of expression: Expression of the transgene is found in all primary cilia of the inner ear sensory epithelium.
Molecular note: The INS*VNTR transgene (Tg(INS*)172Dvs) was created by the Type 1 Diabetes Repository (Dr. David V. Serreze) at The Jackson Laboratory. A human insulin genomic sequence was obtained with 26-63 tandem ACAGGGGTGTGGGG repeats in its promoter region.

Allele

Symbol: Tg(CD2-TcraA1.9,Cd4-TcrbA1.9)1Dvs
Name: transgene insertion 1, David V Serreze
MGI accession ID: MGI:8264707
Generation method: Transgenic
Attributes: Inserted expressed sequence
Synonyms: DQ8-A1.9
Marker symbol: Tg(CD2-TcraA1.9,Cd4-TcrbA1.9)1Dvs
Marker name: transgene insertion 1, David V Serreze
Chromosome: UN
Strain of origin: NOD/ShiLtDvs-H2-K1^d-em1Dvs H2-Ab1^g7-em1Dvs H2-D1^b-em5Dvs/DvsJ
Molecular note: To generate a transgene, human A1.9 TCR sequences recognizing human C-peptide 42-50 in a DQ8-restricted manner were fused to murine constant regions to create chimeric TCR genes. TCRa sequences were inserted into vector pCD2, which drives expression from a human CD2 promoter. TCRb sequences were inserted into p428, which drives expression from a murine CD4 promoter.