NOD.Cg-Prkdc^scid H2-K1^d-em1Dvs H2-Ab1^g7-em1Dvs H2-D1^b-em5Dvs Il2rg^tm1Wjl Tg(HLA-DQA1,HLA-DQB1)1Dv/DvsJ

Stock number: 039055
Product name: NSG-cMHCKO-DQ8 , NSG-cMHCI/II^-/-.DQ8
Research areas: Cancer Research, Diabetes and Obesity Research, Immunology, Inflammation and Autoimmunity Research, Internal/Organ Research, Research Tools, Virology Research

Description

NSG-cMHCI/II^-/-.DQ8 mice carry knock-out alleles for the classical MHC class I genes, H2-D1 and H2-K1, and the class II gene, H2-Ab1 (I-A), and express a transgene encoding human HLA-DQ8: HLA-DQA*0301, DQB*0302 (DQ8) on the NSG^TM (NOD scid gamma) background (Stock No. 005557). NSG incorporates B and T cell deficiencies (Prkdc^scid), a deficiency in functional NK cells (Il2rg^tm1Wjl), and C5 (complement C5) deficiency. These mice do not develop diabetes. This strain is one of a series of mouse models expressing various combinations of HLA I and II alleles plus or minus transgenes encoding disease-relevant human TCRs (hTCRs) isolated from type I diabetes (T1D) patients (Racine, 2023 - PMID: 37877672).

Detailed description

Development of Type 1 diabetes (T1D) is associated with specific major histocompatibility class I and class II variants in both humans and mouse. NSG-cMHCI/II^−/−.DQ8 mice are deficient in classical MHC class I (cMHCI) expression (H2-K1^d-em1Dvs, H2-D1^b-em5Dvs), lack classical MHC class II (cMHCII) molecules (H2-Ab1^g7-em1Dvs), and express a transgene encoding human HLA-DQ8: HLA-DQA*0301, DQB*0302 (DQ8) on the NSG^TM (NOD scid gamma) background (Stock No. 005557). NSG incorporates B and T cell deficiencies (Prkdc^scid), a deficiency in functional NK cells (Il2rg^tm1Wjl), and C5 (complement C5) deficiency. These mice do not develop diabetes.

Development

NOD-cMHCI/II^−/− (NOD/ShiLtDvs-H2-K1^d-em1Dvs H2-Ab1^g7-em1Dvs H2-D1^b-em5Dvs/DvsJ; Stock No. 031858) and NSG.Ab⁰.DQ8 mice (HLA-DQ8: HLA-DQA*0301, DQB*0302; NOD.Cg-Prkdc^scid H2-Ab1^b-tm1Doi Il2rg^tm1Wjl Tg(HLA-DQA1,HLA-DQB1)1Dv/SzJ; Stock No. 026561) were intercrossed and F1 hybrids were backcrossed to the NOD-cMHCI/II^−/− parental strain. Backcross progeny that included the NSG-associated Prkdc^scid and Il2rg^tm1Wjl alleles were then selected for continued breeding. The integration site and the copy number of the HLA transgene are unknown (December, 2023).

Allele

Symbol: Tg(HLA-DQA1,HLA-DQB1)1Dv
Name: transgene insertion 1, Chella David
MGI accession ID: MGI:3586633
Generation method: Transgenic
Attributes: Inserted expressed sequence; Humanized sequence
Synonyms: Abeta⁰.DQ8; DQ8; HLA-DQ8; HLA-DQ8 Tg; HLA-DQA1*0301/DQB1*0302; Tg(HLA-DQA1*301,HLA-DQB1*302)1Dv
Marker symbol: Tg(HLA-DQA1,HLA-DQB1)1Dv
Marker name: transgene insertion 1, Chella David
Marker synonyms: Abeta⁰.DQ8; DQ8; HLA-DQ8; HLA-DQ8 Tg; Tg(HLA-DQA1*301,HLA-DQB1*302)1Dv
Chromosome: UN
Strain of origin: (CBA/J x B10.M-H2^f)F2
Expressed genes: HLA-DQA1,major histocompatibility complex, class II, DQ alpha 1,human; HLA-DQB1,major histocompatibility complex, class II, DQ beta 1,human
Molecular note: A 30-kb human genomic DNA fragment containing the entire HLA-DQA1*0301 gene and a promoter-truncated HLA-DQB1*0302 gene from cosmid H11A and a 38-kb DNA fragment containing the entire HLA-DQB1*0302 gene from cosmid X10A were coinjected.
General note: Flow cytometric analysis of peripheral blood leukocytes (PBL) using a monoclonal antibody to HLA-DQ demonstrated that transgenic mice express the transgenes. 25-40% of the PBLs of mixed-background transgenic mice homozygous for the targeted MHC class II mutation H2-Ab1^tm1Dim express the transgenes. Lymph nodes of such mice contain three-fold the levels of CD4⁺ CD44⁺ T-cells as do those of nontransgenic MHC class II-deficient mice, levels similar to those of class II-sufficient mice. Immunization of transgenic H2-Ab1^tm1Dim homozygous mice with bovine collagen II results in a strong IgG antibody response to the immunogen, and 66% of these mice develop severe, persistent arthritis. (J:88296)

Allele

Symbol: H2-Ab1^g7-em1Dvs
Name: endonuclease-mediated mutation 1, Jackson
MGI accession ID: MGI:6101479
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Synonyms: H2-Ab1^em1Dvs
Marker symbol: H2-Ab1
Marker name: histocompatibility 2, class II antigen A, beta 1
Marker synonyms: A beta; Abeta; Bb; CELIAC1; DQB2; H-2Ab; H2-Ab; HLA-DQB; HLA-DQB1; HLA-DXB; I-A^b; Ia2; Ia-2; IAb; I-Abeta; IDDM1; Rmcs1; RT1.B
Chromosome: 17
Strain of origin: NOD/ShiLtDvs-H2-K1^d-em1Dvs H2-D1^b-em5Dvs/Dvs
Molecular note: Cas9 RNA and four guide sequences targeting Exon 2 (CCAACGGGACGCAGCGCATA, CGAAGCGCAGGTACTCCTCC, CGACGTGGGCGAGTACCGCG, ACACAACTACGAGGAGACGG) were injected into NOD/ShiLtDvs-H2-K1^em1Dvs H2-D1^em5Dvs/Dvs embryos yielding this 181bp deletion (ATACGGCTCGTGACCAGATACATCTACAACCGGGAGGAGTACCTGCGCTTCGACAGCGACGTGGGCGAGTACCGCGCGGT GACCGAGCTGGGGCGGCACTCAGCCGAGTACTACAATAAGCAGTACCTGGAGCGAACGCGGGCCGAGCTGGACACGGCGT GCAGACACAACTACGAGGAGA) within Exon 2 of H2-Ab1. Flow cytometry showed a paucity of CD8+ and CD4+ T-cells in the blood, and flow cytometry showing loss of H2-D, H2-K, and I-A on blood B-cells.

Allele

Symbol: H2-K1^d-em1Dvs
Name: endonuclease-mediated mutation 1, David V Serreze
MGI accession ID: MGI:6119459
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Synonyms: H2-K1^em1Dvs
Marker symbol: H2-K1
Marker name: histocompatibility 2, K1, K region
Marker synonyms: AS; B-4901; CDA12; D6S204; H-2K; HLA-5.4; HLA-6.2; HLAA; HLAB; HLAC; HLA-CDA12; HLAF; HLAHP; HLA-JY3; HLC-C; MHC; MHC-G; PSORS1; QA1; RT1.A2(N); RT1.Cg; RT1A-2; RT1-A2n; RT1-C/E1; RT1-C/E2; RT1-CE12; RT1-Uav1; RT1-Uc; RT1-Ulv1
Chromosome: 17
Strain of origin: NOD/ShiLtDvs
Molecular note: This single nucleotide (G) deletion within exon 2 was shown by flow cytometry to cause a null allele. it was generated by injection of Cas9 and guide sequences GTACATCTCTGTCGGCTATG targeting H2-D1^b and ATAATCCGAGATTTGAGCCG targeting H2-K1^d into NOD/ShiLtDvs embryos, which resulted in this point deletion and the intragenic deletions of H2-D1^em5Dvs.

Allele

Symbol: Prkdc^scid
Name: severe combined immunodeficiency
MGI accession ID: MGI:1857113
Generation method: Spontaneous
Synonyms: scid
Marker symbol: Prkdc
Marker name: protein kinase, DNA activated, catalytic polypeptide
Marker synonyms: DNAPDcs; DNAPK; DNA-PK; DNAPKc; DNA-PKC; DNA-PKcs; DNPK1; DOXNPH; dxnph; HYRC; HYRC1; IMD26; p350; S473K; slip; XRCC7
Chromosome: 16
Strain of origin: C.BKa-Igh^b/Icr
Site of expression: T and B lymphocytes.
Molecular note: A T-to-A transversion point mutation at a position corresponding to codon 4046 (codon 4095 in transcript ENSMUST00000023352.8) created a premature stop codon (p.Y4046*).

Allele

Symbol: Il2rg^tm1Wjl
Name: targeted mutation 1, Warren J Leonard
MGI accession ID: MGI:1857455
Generation method: Targeted
Attributes: Null/Knockout
Synonyms: [KO]gammac; CD132^-; gammac^-; gc^-; Il2rg^tm1Wjll; IL2Rgamma^null
Marker symbol: Il2rg
Marker name: interleukin 2 receptor, gamma chain
Marker synonyms: [g]c; Ab2-183; Cd132; CIDX; common cytokine receptor gamma chain; common gamma chain; gamma C receptor; gamma(c); gammaC; gc; IL-2RG; IMD4; P64; SCIDX; SCIDX1
Chromosome: X
Strain of origin: 129S4/SvJae
Site of expression: Primarily lymphoid cells.
Molecular note: A neomycin resistance cassette replaced part of exon 3 and all of exons 4 - 8 of the gene, resulting in the loss of most of the extracellular domain and all of the transmembrane and cytoplasmic domains of the protein.

Allele

Symbol: H2-D1^b-em5Dvs
Name: endonuclease-mediated mutation 5, David V Serreze
MGI accession ID: MGI:6119467
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: H2-D1
Marker name: histocompatibility 2, D region locus 1
Marker synonyms: AS; B-4901; CDA12; D6S204; H-2D; HLA-5.4; HLA-6.2; HLAA; HLAB; HLAC; HLA-CDA12; HLAF; HLAHP; HLA-JY3; HLC-C; MHC; MHC-G; PSORS1; QA1; RT1.A2(N); RT1.Cg; RT1A-2; RT1-A2n; RT1-C/E1; RT1-C/E2; RT1-CE12; RT1-Uav1; RT1-Uc; RT1-Ulv1
Chromosome: 17
Strain of origin: NOD/ShiLtDvs
Molecular note: Cas9 and guide sequences GTACATCTCTGTCGGCTATG targeting H2-D1^b and ATAATCCGAGATTTGAGCCG targeting H2-K1^d were injected into NOD/ShiLtDvs embryos resulting in two deletions in exon 2, one 11 bp and one 3 bp, in addition to the single nucleotide deletion that is H2-K1^em1Dvs.