NOD.Cg-H2-K1^d-em1Dvs H2-Ab1^g7-em1Dvs H2-D1^b-em5Dvs Tg(HLA-A/H2-D/B2M)1Dvs Tg(HLA-DQA1,HLA-DQB1)1Dv/DvsJ

Stock number: 039054
Product name: NOD-cMHCKO-DQ8-A2 , NOD-cMHCI/II^-/-.DQ8-A2 , DQ8-A2
Research areas: Diabetes and Obesity Research, Immunology, Inflammation and Autoimmunity Research, Research Tools

Description

NOD-cMHCI/II^-/-.DQ8-A2 (DQ8-A2) mice express both HLA-DQ8 and HLA-A2 while lacking classical murine MHC molecules. This allows the selection of both CD4⁺ and CD8⁺ T cells that are human HLA-DQ8 or HLA-A2 restricted. These mice do not develop diabetes, but do develop myocarditis. This strain is one of a series of mouse models expressing various combinations of HLA I and II alleles plus or minus transgenes encoding disease-relevant human TCRs (hTCRs) isolated from type I diabetes (T1D) patients (Racine, 2023 - PMID: 37877672).

Detailed description

Development of Type 1 diabetes (T1D) is associated with specific major histocompatibility class I and class II variants in both humans and mouse. NOD-cMHCI/II^−/−.DQ8-A2 (DQ8-A2) mice express both HLA-DQ8 and HLA-A2 while lacking classical murine MHC molecules. This allows the selection of both CD4⁺ and CD8⁺ T cells that are human HLA-DQ8 or HLA-A2 restricted. These mice do not develop diabetes, but do develop myocarditis; a significant loss of animals is observed around 5-6 months of age. The donating laboratory maintains young breeders for a relatively short time during which they have a maximum of 2-3 litters.

The mice are deficient in classical MHC class I (cMHCI) expression (H2-K1^d-em1Dvs, H2-D1^b-em5Dvs), lack classical MHC class II (cMHCII) molecules (H2-Ab1^g7-em1Dvs), express a transgene encoding a human β 2-microglubulin (B2M) covalently linked to the MHC class I, -alpha1 and alpha2 antigen binding domains of the human HLA-A2.1 (HLA-A*02:01) gene and the alpha3, cytoplasmic and transmembrane domains of murine H2-D1^b (Tg(HLA-A/H2-D/B2M)1Dvs), and express a transgene encoding human HLA-DQ8: HLA-DQA*0301, DQB*0302 (DQ8).

Development

NOD-cMHCI/II^−/−-A2 (NOD/ShiLtDvs-H2-K1^d-em1Dvs H2-Ab1^g7-em1Dvs H2-D1^b-em5Dvs Tg(HLA-A/H2-D/B2M)1Dvs/Dvs; Stock No. 031433) and NOD-cMHCI/II^−/−.DQ8 (NOD.Cg-H2-K1^d-em1Dvs H2-Ab1^g7-em1Dvs H2-D1^b-em5Dvs Tg(HLA-DQA1,HLA-DQB1)1Dv/DvsJ; Stock No. 039053) mice were intercrossed to generate this NOD-cMHCI/II^−/−.DQ8-A2 (DQ8-A2) strain (Stock No. 039054). The integration site and the copy number of the HLA transgenes are unknown (December, 2023).

Allele

Symbol: Tg(HLA-DQA1,HLA-DQB1)1Dv
Name: transgene insertion 1, Chella David
MGI accession ID: MGI:3586633
Generation method: Transgenic
Attributes: Inserted expressed sequence; Humanized sequence
Synonyms: Abeta⁰.DQ8; DQ8; HLA-DQ8; HLA-DQ8 Tg; HLA-DQA1*0301/DQB1*0302; Tg(HLA-DQA1*301,HLA-DQB1*302)1Dv
Marker symbol: Tg(HLA-DQA1,HLA-DQB1)1Dv
Marker name: transgene insertion 1, Chella David
Marker synonyms: Abeta⁰.DQ8; DQ8; HLA-DQ8; HLA-DQ8 Tg; Tg(HLA-DQA1*301,HLA-DQB1*302)1Dv
Chromosome: UN
Strain of origin: (CBA/J x B10.M-H2^f)F2
Expressed genes: HLA-DQA1,major histocompatibility complex, class II, DQ alpha 1,human; HLA-DQB1,major histocompatibility complex, class II, DQ beta 1,human
Molecular note: A 30-kb human genomic DNA fragment containing the entire HLA-DQA1*0301 gene and a promoter-truncated HLA-DQB1*0302 gene from cosmid H11A and a 38-kb DNA fragment containing the entire HLA-DQB1*0302 gene from cosmid X10A were coinjected.
General note: Flow cytometric analysis of peripheral blood leukocytes (PBL) using a monoclonal antibody to HLA-DQ demonstrated that transgenic mice express the transgenes. 25-40% of the PBLs of mixed-background transgenic mice homozygous for the targeted MHC class II mutation H2-Ab1^tm1Dim express the transgenes. Lymph nodes of such mice contain three-fold the levels of CD4⁺ CD44⁺ T-cells as do those of nontransgenic MHC class II-deficient mice, levels similar to those of class II-sufficient mice. Immunization of transgenic H2-Ab1^tm1Dim homozygous mice with bovine collagen II results in a strong IgG antibody response to the immunogen, and 66% of these mice develop severe, persistent arthritis. (J:88296)

Allele

Symbol: Tg(HLA-A/H2-D/B2M)1Dvs
Name: transgene insertion 1, David V Serreze
MGI accession ID: MGI:3711057
Generation method: Transgenic
Attributes: Inserted expressed sequence; Humanized sequence
Synonyms: HDD; HHD
Marker symbol: Tg(HLA-A/H2-D/B2M)1Dvs
Marker name: transgene insertion 1, David Serreze
Marker synonyms: HDD; HHD
Chromosome: UN
Strain of origin: NOD/ShiLtDvs
Expressed genes: B2M,beta-2-microglobulin,human; HLA-A,major histocompatibility complex, class I, A,human
Molecular note: This transgene encodes a human B2-microglubulin (B2M) covalently linked to the MHC class 1, alpha1 and alpha2 binding domains of the human HLA-A2.1 gene, and the alpha3, cytoplasmic and transmembrane domains of the murine H2-D^b. The construct was injected into fertilized NOD/ShiLtDvs oocytes. The construct was originally described in J:41077 and used to create a different transgenic line.
General note: The HDD construct was created and used to generate a differnet transgenic mouse line in J:41077.

Allele

Symbol: H2-Ab1^g7-em1Dvs
Name: endonuclease-mediated mutation 1, Jackson
MGI accession ID: MGI:6101479
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Synonyms: H2-Ab1^em1Dvs
Marker symbol: H2-Ab1
Marker name: histocompatibility 2, class II antigen A, beta 1
Marker synonyms: A beta; Abeta; Bb; CELIAC1; DQB2; H-2Ab; H2-Ab; HLA-DQB; HLA-DQB1; HLA-DXB; I-A^b; Ia2; Ia-2; IAb; I-Abeta; IDDM1; Rmcs1; RT1.B
Chromosome: 17
Strain of origin: NOD/ShiLtDvs-H2-K1^d-em1Dvs H2-D1^b-em5Dvs/Dvs
Molecular note: Cas9 RNA and four guide sequences targeting Exon 2 (CCAACGGGACGCAGCGCATA, CGAAGCGCAGGTACTCCTCC, CGACGTGGGCGAGTACCGCG, ACACAACTACGAGGAGACGG) were injected into NOD/ShiLtDvs-H2-K1^em1Dvs H2-D1^em5Dvs/Dvs embryos yielding this 181bp deletion (ATACGGCTCGTGACCAGATACATCTACAACCGGGAGGAGTACCTGCGCTTCGACAGCGACGTGGGCGAGTACCGCGCGGT GACCGAGCTGGGGCGGCACTCAGCCGAGTACTACAATAAGCAGTACCTGGAGCGAACGCGGGCCGAGCTGGACACGGCGT GCAGACACAACTACGAGGAGA) within Exon 2 of H2-Ab1. Flow cytometry showed a paucity of CD8+ and CD4+ T-cells in the blood, and flow cytometry showing loss of H2-D, H2-K, and I-A on blood B-cells.

Allele

Symbol: H2-K1^d-em1Dvs
Name: endonuclease-mediated mutation 1, David V Serreze
MGI accession ID: MGI:6119459
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Synonyms: H2-K1^em1Dvs
Marker symbol: H2-K1
Marker name: histocompatibility 2, K1, K region
Marker synonyms: AS; B-4901; CDA12; D6S204; H-2K; HLA-5.4; HLA-6.2; HLAA; HLAB; HLAC; HLA-CDA12; HLAF; HLAHP; HLA-JY3; HLC-C; MHC; MHC-G; PSORS1; QA1; RT1.A2(N); RT1.Cg; RT1A-2; RT1-A2n; RT1-C/E1; RT1-C/E2; RT1-CE12; RT1-Uav1; RT1-Uc; RT1-Ulv1
Chromosome: 17
Strain of origin: NOD/ShiLtDvs
Molecular note: This single nucleotide (G) deletion within exon 2 was shown by flow cytometry to cause a null allele. it was generated by injection of Cas9 and guide sequences GTACATCTCTGTCGGCTATG targeting H2-D1^b and ATAATCCGAGATTTGAGCCG targeting H2-K1^d into NOD/ShiLtDvs embryos, which resulted in this point deletion and the intragenic deletions of H2-D1^em5Dvs.

Allele

Symbol: H2-D1^b-em5Dvs
Name: endonuclease-mediated mutation 5, David V Serreze
MGI accession ID: MGI:6119467
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: H2-D1
Marker name: histocompatibility 2, D region locus 1
Marker synonyms: AS; B-4901; CDA12; D6S204; H-2D; HLA-5.4; HLA-6.2; HLAA; HLAB; HLAC; HLA-CDA12; HLAF; HLAHP; HLA-JY3; HLC-C; MHC; MHC-G; PSORS1; QA1; RT1.A2(N); RT1.Cg; RT1A-2; RT1-A2n; RT1-C/E1; RT1-C/E2; RT1-CE12; RT1-Uav1; RT1-Uc; RT1-Ulv1
Chromosome: 17
Strain of origin: NOD/ShiLtDvs
Molecular note: Cas9 and guide sequences GTACATCTCTGTCGGCTATG targeting H2-D1^b and ATAATCCGAGATTTGAGCCG targeting H2-K1^d were injected into NOD/ShiLtDvs embryos resulting in two deletions in exon 2, one 11 bp and one 3 bp, in addition to the single nucleotide deletion that is H2-K1^em1Dvs.