NOD.Cg-H2-K1^d-em1Dvs H2-Ab1^g7-em1Dvs H2-D1^b-em5Dvs Tg(HLA-DQA1,HLA-DQB1)1Dv/DvsJ

Stock number: 039053
Product name: NOD-cMHCKO-DQ8 , NOD-cMHCI/II^-/-.DQ8 , DQ8
Research areas: Cardiovascular Research, Diabetes and Obesity Research, Immunology, Inflammation and Autoimmunity Research, Internal/Organ Research, Research Tools

Description

NOD-cMHCI/II^-/-.DQ8 (DQ8) mice carry knock-out alleles for the classical MHC class I genes, H2-D1 and H2-K1, and the class II gene, H2-Ab1 (I-A), and express a transgene encoding human HLA-DQ8: HLA-DQA*0301, DQB*0302 (DQ8). These mice do not develop diabetes, but do develop myocarditis with cellular infiltration and fibrosis. This strain is one of a series of mouse models expressing various combinations of HLA I and II alleles plus or minus transgenes encoding disease-relevant human TCRs (hTCRs) isolated from type I diabetes (T1D) patients (Racine, 2023 - PMID: 37877672).

Detailed description

Development of Type 1 diabetes (T1D) is associated with specific major histocompatibility class I and class II variants in both humans and mouse. NOD-cMHCI/II^−/−.DQ8 (DQ8) mice are deficient in classical MHC class I (cMHCI) expression (H2-K1^d-em1Dvs, H2-D1^b-em5Dvs), lack classical MHC class II (cMHCII) molecules (H2-Ab1^g7-em1Dvs), and express a transgene encoding human HLA-DQ8: HLA-DQA*0301, DQB*0302 (DQ8). NOD-cMHCKO-A2 mice generate predominantly CD4⁺ T cells and develop myocarditis with cellular infiltration and fibrosis. These mice do not develop diabetes.

Development

NOD-cMHCI/II^−/− (NOD/ShiLtDvs-H2-K1^d-em1Dvs H2-Ab1^g7-em1Dvs H2-D1^b-em5Dvs/DvsJ; Stock No. 031858) and NSG.Ab⁰.DQ8 mice (NOD.Cg-Prkdc^scid H2-Ab1^b-tm1Doi Il2rg^tm1Wjl Tg(HLA-DQA1,HLA-DQB1)1Dv/SzJ; Stock No. 026561 carrying HLA-DQ8: HLA-DQA*0301, DQB*0302) were intercrossed and F1 hybrids were backcrossed to the NOD-cMHCI/II^−/− parental strain. Backcross progeny lacking the NSG-associated Prkdc^scid and Il2rg^tm1Wjl alleles were then selected for continued breeding. The integration site and the copy number of the HLA transgene are unknown (December, 2023).

Allele

Symbol: Tg(HLA-DQA1,HLA-DQB1)1Dv
Name: transgene insertion 1, Chella David
MGI accession ID: MGI:3586633
Generation method: Transgenic
Attributes: Inserted expressed sequence; Humanized sequence
Synonyms: Abeta⁰.DQ8; DQ8; HLA-DQ8; HLA-DQ8 Tg; HLA-DQA1*0301/DQB1*0302; Tg(HLA-DQA1*301,HLA-DQB1*302)1Dv
Marker symbol: Tg(HLA-DQA1,HLA-DQB1)1Dv
Marker name: transgene insertion 1, Chella David
Marker synonyms: Abeta⁰.DQ8; DQ8; HLA-DQ8; HLA-DQ8 Tg; Tg(HLA-DQA1*301,HLA-DQB1*302)1Dv
Chromosome: UN
Strain of origin: (CBA/J x B10.M-H2^f)F2
Expressed genes: HLA-DQA1,major histocompatibility complex, class II, DQ alpha 1,human; HLA-DQB1,major histocompatibility complex, class II, DQ beta 1,human
Molecular note: A 30-kb human genomic DNA fragment containing the entire HLA-DQA1*0301 gene and a promoter-truncated HLA-DQB1*0302 gene from cosmid H11A and a 38-kb DNA fragment containing the entire HLA-DQB1*0302 gene from cosmid X10A were coinjected.
General note: Flow cytometric analysis of peripheral blood leukocytes (PBL) using a monoclonal antibody to HLA-DQ demonstrated that transgenic mice express the transgenes. 25-40% of the PBLs of mixed-background transgenic mice homozygous for the targeted MHC class II mutation H2-Ab1^tm1Dim express the transgenes. Lymph nodes of such mice contain three-fold the levels of CD4⁺ CD44⁺ T-cells as do those of nontransgenic MHC class II-deficient mice, levels similar to those of class II-sufficient mice. Immunization of transgenic H2-Ab1^tm1Dim homozygous mice with bovine collagen II results in a strong IgG antibody response to the immunogen, and 66% of these mice develop severe, persistent arthritis. (J:88296)

Allele

Symbol: H2-K1^d-em1Dvs
Name: endonuclease-mediated mutation 1, David V Serreze
MGI accession ID: MGI:6119459
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Synonyms: H2-K1^em1Dvs
Marker symbol: H2-K1
Marker name: histocompatibility 2, K1, K region
Marker synonyms: AS; B-4901; CDA12; D6S204; H-2K; HLA-5.4; HLA-6.2; HLAA; HLAB; HLAC; HLA-CDA12; HLAF; HLAHP; HLA-JY3; HLC-C; MHC; MHC-G; PSORS1; QA1; RT1.A2(N); RT1.Cg; RT1A-2; RT1-A2n; RT1-C/E1; RT1-C/E2; RT1-CE12; RT1-Uav1; RT1-Uc; RT1-Ulv1
Chromosome: 17
Strain of origin: NOD/ShiLtDvs
Molecular note: This single nucleotide (G) deletion within exon 2 was shown by flow cytometry to cause a null allele. it was generated by injection of Cas9 and guide sequences GTACATCTCTGTCGGCTATG targeting H2-D1^b and ATAATCCGAGATTTGAGCCG targeting H2-K1^d into NOD/ShiLtDvs embryos, which resulted in this point deletion and the intragenic deletions of H2-D1^em5Dvs.

Allele

Symbol: H2-D1^b-em5Dvs
Name: endonuclease-mediated mutation 5, David V Serreze
MGI accession ID: MGI:6119467
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: H2-D1
Marker name: histocompatibility 2, D region locus 1
Marker synonyms: AS; B-4901; CDA12; D6S204; H-2D; HLA-5.4; HLA-6.2; HLAA; HLAB; HLAC; HLA-CDA12; HLAF; HLAHP; HLA-JY3; HLC-C; MHC; MHC-G; PSORS1; QA1; RT1.A2(N); RT1.Cg; RT1A-2; RT1-A2n; RT1-C/E1; RT1-C/E2; RT1-CE12; RT1-Uav1; RT1-Uc; RT1-Ulv1
Chromosome: 17
Strain of origin: NOD/ShiLtDvs
Molecular note: Cas9 and guide sequences GTACATCTCTGTCGGCTATG targeting H2-D1^b and ATAATCCGAGATTTGAGCCG targeting H2-K1^d were injected into NOD/ShiLtDvs embryos resulting in two deletions in exon 2, one 11 bp and one 3 bp, in addition to the single nucleotide deletion that is H2-K1^em1Dvs.