C57BL/6N-Mlkl^em1Najaf/J

Stock number: 039024
Product name: MLKLS^345A;S347A; SA2

Research areas: Immunology, Inflammation and Autoimmunity Research, Research Tools

Description

MLKL^S345A;S347A or SA2 knock-in mice have two amino acid substitutions (S345A, S347A) inserted into the Mlkl (mixed lineage kinase domain-like). Homozygous mice are resistant to TNFα-induced systemic inflammatory response syndrome (SIRS). These mice may be useful for studies of necroptosis.

Detailed description

Mlkl (mixed lineage kinase domain-like) encodes a member of the protein kinase superfamily. Activation of MLKL through phosphorylation by RIPK3 is essential to necroptosis, a form of programmed necrotic cell death. Necroptosis is involved in many inflammatory diseases including pancreatitis, inflammatory bowel disease, allergic immune responses and a range of infections.

MLKL^S345A;S347A or SA2 knockin mice were created using CRISPR/cas9 genome editing to insert two amino acid substitutions (S345A, S347A) into the Mlkl locus. The substitutions block RIPK3 phosphorylation events blocking necroptotic cell death. Mice homozygous for the SA2 mutation are viable and fertile. Mouse embryonic fibroblasts from SA2 mice are resistant to necroptosis. Homozygous SA2 are resistant to TNFα-induced systemic inflammatory response syndrome (SIRS).

Development

CRISPR/Cas9 endonuclease-mediated genome editing is used to insert serine to alanine amino acid substitutions at codons 345 and 347 (S345A TCC to GCC, S347A AGC to GCC) in exon 8 of the Mlkl (mixed lineage kinase domain-like) locus on chromosome 8. Mlkl transcript Mlkl-201 (ENSMUSG00000012519) was used as reference for the exon number and guide sequences. crRNA (AAACACAGAAUUCCAUCAGCGUUUUAGAGCUAUGCUGUUUUG), cas9 endonuclease and a single strain oligo template (tttcaacgtctgcatctaacacatctgtctgtctagCTTGCAGGATTTGAGTTAAGCAAAACACAGAATGCCAT CGCCCGAACAGCAAAGAGCACTAAAGCAGAGAGATCCAGTTCAACG) were electroporated into C57BL/6NCrl-derived zygotes. Embryos were transferred to pseudopregnant females, and correctly targeted pups were bred to C57BL/6N mice for germline transmission and then bred to C57BL/6N for 6 generations. PCR and Sanger DNA sequencing confirmed the mutation. The colony was maintained on the C57BL/6N background. Upon arrival, mice were bred to C57BL/6NJ (Stock No. 005304) for at least one generation to establish the colony.

Allele

Symbol: Mlkl^em1Najaf
Name: endonuclease-mediated mutation 1, Ayaz Najafov
MGI accession ID: MGI:7550372
Generation method: Endonuclease-mediated
Attributes: Not Applicable
Synonyms: MLKL^S345A;S347A; SA2
Marker symbol: Mlkl
Marker name: mixed lineage kinase domain-like
Marker synonyms: 9130019I15Rik; hMLKL
Chromosome: 8
Strain of origin: C57BL/6NCrl
Molecular note: CRISPR/cas9 endonuclease-mediated genome editing is used to insert serine to alanine amino acid substitutions at codons 345 and 347 (S345A TCC to GCC, S347A AGC to GCC) in exon 8. Mlkl transcript Mlkl-201 (ENSMUSG00000012519) was used as reference for the exon number and guide sequences. crRNA (AAACACAGAAUUCCAUCAGCGUUUUAGAGCUAUGCUGUUUUG), cas9 endonuclease and a single strain oligo template (tttcaacgtctgcatctaacacatctgtctgtctagCTTGCAGGATTTGAGTTAAGCAAAACACAGAATGCCAT CGCCCGAACAGCAAAGAGCACTAAAGCAGAGAGATCCAGTTCAACG) are used. The substitutions block RIPK3 phosphorylation events blocking necroptotic cell death.